WDR1 (WD Repeat Domain 1, WDR1)

Short Description: This gene encodes a protein containing 9 WD repeats. WD repeats are approximately 30- to 40-amino acid domains containing several conserved residues, mostly including a trp-asp at the C-terminal end. WD domains are involved in protein-protein interactions. The encoded protein may help induce the disassembly of actin filaments. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].
More information related to gene WDR1.
Products related to WDR1 Gene:
160 Products
Data Quality
  • 1
Type
  • 156
  • 4
Species
  • 73
  • 45
  • 29
  • 6
  • 3
Application
  • 99
  • 49
  • 25
  • 16
Fusion tag
  • 60
  • 18
  • 16
  • 12
  • 8
Vector Backbone
  • 11
  • 7
  • 7
  • 6
  • 6
Vector
  • 75
  • 38
  • 16
  • 14
  • 9
Insert
  • 63
  • 56
  • 21
  • 8
  • 6
Oligo-Type
  • 4
Resistance Gene
  • 68
  • 56
  • 24
  • 8
  • 2
Expression Type
  • 116
  • 57
  • 26
Selectable Marker
  • 37
  • 26
  • 26
  • 1
Promoter
  • 49
  • 40
  • 31
  • 16
  • 8
Format
  • 70
  • 36
  • 32
  • 22

Type:
ORF
Application:
Protein Expression
Gene:
WD Repeat Domain 1 (WDR1)
NCBI Accession:
NM_017491,NP_059830
Species:
Human
Synonyms:
WDR1, Wdr1
Insert length:
1821 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5379871
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
WD Repeat Domain 1 (WDR1)
Gene ID:
394014 (Zebrafish (Danio rerio), WDR1)
Synonyms:
WDR1, Wdr1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3877692
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
WD Repeat Domain 1 (WDR1)
Gene ID:
398123 (Xenopus laevis, WDR1)
Synonyms:
WDR1, Wdr1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3845549
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
WD Repeat Domain 1 (WDR1)
Gene ID:
398123 (Xenopus laevis, WDR1)
Synonyms:
WDR1, Wdr1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3845550
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
WD Repeat Domain 1 (WDR1)
Gene ID:
533223 (Cow (Bovine), WDR1)
Synonyms:
WDR1, Wdr1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3862137
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
WD Repeat Domain 1 (WDR1)
Gene ID:
9948 (Human, WDR1)
Synonyms:
WDR1, Wdr1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3466061
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
WD Repeat Domain 1 (WDR1)
Gene ID:
398797 (Xenopus laevis, WDR1)
Synonyms:
WDR1, Wdr1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3462126
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
WD Repeat Domain 1 (WDR1)
Gene ID:
448473 (Xenopus tropicalis, WDR1)
Synonyms:
WDR1, Wdr1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3885374
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
WD Repeat Domain 1 (WDR1)
Gene ID:
9948 (Human, WDR1)
Synonyms:
WDR1, Wdr1
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4088536
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
WD Repeat Domain 1 (WDR1)
Gene ID:
9948 (Human, WDR1)
Synonyms:
WDR1, Wdr1
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4088537
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
WD Repeat Domain 1 (WDR1)
Gene ID:
360950 (Rat (Rattus), WDR1)
Synonyms:
WDR1, Wdr1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4054769
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
WD Repeat Domain 1 (WDR1)
Gene ID:
22388 (Mouse (Murine), WDR1)
Synonyms:
WDR1, Wdr1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4004145
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
WD Repeat Domain 1 (WDR1)
Gene ID:
22388 (Mouse (Murine), WDR1)
Synonyms:
WDR1, Wdr1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4004144
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
WD Repeat Domain 1 (WDR1)
NCBI Accession:
NM_011715
Species:
Mouse (Murine)
Synonyms:
WDR1, Wdr1
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3573934
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
WD Repeat Domain 1 (WDR1)
NCBI Accession:
NM_017491
Species:
Human
Synonyms:
WDR1, Wdr1
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3573933
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
WD Repeat Domain 1 (WDR1)
Gene ID:
394014 (Zebrafish (Danio rerio), WDR1)
Synonyms:
WDR1, Wdr1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3845073
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
WD Repeat Domain 1 (WDR1)
Species:
Human
Synonyms:
WDR1, Wdr1
Insert length:
1821 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5733926
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Cloning
Gene:
WD Repeat Domain 1 (WDR1)
Species:
Human
Synonyms:
WDR1, Wdr1
Insert length:
1821 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5733927
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
WD Repeat Domain 1 (WDR1)
Gene ID:
398123 (Xenopus laevis, WDR1)
Synonyms:
WDR1, Wdr1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3845551
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
WD Repeat Domain 1 (WDR1)
Gene ID:
398123 (Xenopus laevis, WDR1)
Synonyms:
WDR1, Wdr1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3845552
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to WDR1

  • WD repeat domain 1 (WDR1)
  • WD repeat domain 1 (Wdr1)
  • AIP1
  • Aip1
  • D5Wsu185e
  • NORI-1
  • rede

Gene-IDs for different species

GENE IDSPECIES
422842 Gallus gallus
9948 Homo sapiens
533223 Bos taurus
22388 Mus musculus
360950 Rattus norvegicus

Protein level used designations for WDR1

  • AIP1
  • WD repeat-containing protein 1
  • actin-interacting protein 1
  • WD40 repeat protein 1
  • WD repeat protein 1
Other products related to WDR1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com