WDR1 (WD Repeat Domain 1, WDR1)

Short Description: This gene encodes a protein containing 9 WD repeats. WD repeats are approximately 30- to 40-amino acid domains containing several conserved residues, mostly including a trp-asp at the C-terminal end. WD domains are involved in protein-protein interactions. The encoded protein may help induce the disassembly of actin filaments. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].
More information related to gene WDR1.
Products related to WDR1 Gene:
Data Quality
  • 1
  • 153
  • 3
  • 71
  • 44
  • 28
  • 6
  • 3
  • 99
  • 49
  • 21
  • 16
Fusion tag
  • 59
  • 16
  • 15
  • 12
  • 8
Vector Backbone
  • 11
  • 7
  • 7
  • 6
  • 6
  • 72
  • 38
  • 16
  • 14
  • 9
  • 63
  • 56
  • 18
  • 8
  • 6
  • 3
Resistance Gene
  • 65
  • 56
  • 24
  • 8
  • 2
Expression Type
  • 113
  • 54
  • 26
Selectable Marker
  • 34
  • 26
  • 26
  • 1
  • 49
  • 37
  • 28
  • 16
  • 8
  • 66
  • 36
  • 32
  • 22
156 Products

WD Repeat Domain 1 (WDR1)
WDR1, Wdr1
Insert length:
1821 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5733926
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

WD Repeat Domain 1 (WDR1)
WDR1, Wdr1
Insert length:
1821 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5733927
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression
WD Repeat Domain 1 (WDR1)
NCBI Accession:
WDR1, Wdr1
Insert length:
1821 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5379871
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression, Cloning
WD Repeat Domain 1 (WDR1)
Gene ID:
394014 (Zebrafish (Danio rerio), WDR1)
WDR1, Wdr1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3877692
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
WD Repeat Domain 1 (WDR1)
Gene ID:
398123 (Xenopus laevis, WDR1)
WDR1, Wdr1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3845549
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
WD Repeat Domain 1 (WDR1)
Gene ID:
398123 (Xenopus laevis, WDR1)
WDR1, Wdr1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3845550
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
WD Repeat Domain 1 (WDR1)
Gene ID:
533223 (Cow (Bovine), WDR1)
WDR1, Wdr1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3862137
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
WD Repeat Domain 1 (WDR1)
Gene ID:
448473 (Xenopus tropicalis, WDR1)
WDR1, Wdr1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3885374
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

WD Repeat Domain 1 (WDR1)
Gene ID:
22388 (Mouse (Murine), WDR1)
WDR1, Wdr1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4004144
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

WD Repeat Domain 1 (WDR1)
Gene ID:
22388 (Mouse (Murine), WDR1)
WDR1, Wdr1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4004145
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
WD Repeat Domain 1 (WDR1)
Gene ID:
360950 (Rat (Rattus), WDR1)
WDR1, Wdr1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4054769
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
WD Repeat Domain 1 (WDR1)
Gene ID:
398797 (Xenopus laevis, WDR1)
WDR1, Wdr1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3462126
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
WD Repeat Domain 1 (WDR1)
Gene ID:
9948 (Human, WDR1)
WDR1, Wdr1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3466061
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

WD Repeat Domain 1 (WDR1)
Gene ID:
9948 (Human, WDR1)
WDR1, Wdr1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4088536
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

WD Repeat Domain 1 (WDR1)
Gene ID:
9948 (Human, WDR1)
WDR1, Wdr1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4088537
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

WD Repeat Domain 1 (WDR1)
NCBI Accession:
WDR1, Wdr1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3573933
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

WD Repeat Domain 1 (WDR1)
NCBI Accession:
Mouse (Murine)
WDR1, Wdr1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3573934
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Protein Expression, Cloning
WD Repeat Domain 1 (WDR1)
Gene ID:
394014 (Zebrafish (Danio rerio), WDR1)
WDR1, Wdr1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3845073
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
WD Repeat Domain 1 (WDR1)
Gene ID:
398123 (Xenopus laevis, WDR1)
WDR1, Wdr1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3845551
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
WD Repeat Domain 1 (WDR1)
Gene ID:
398123 (Xenopus laevis, WDR1)
WDR1, Wdr1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3845552
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to WDR1

  • WD repeat domain 1 (WDR1)
  • WD repeat domain 1 (Wdr1)
  • AIP1
  • Aip1
  • D5Wsu185e
  • NORI-1
  • rede

Gene-IDs for different species

422842 Gallus gallus
9948 Homo sapiens
533223 Bos taurus
22388 Mus musculus
360950 Rattus norvegicus

Protein level used designations for WDR1

  • AIP1
  • WD repeat-containing protein 1
  • actin-interacting protein 1
  • WD40 repeat protein 1
  • WD repeat protein 1
Other products related to WDR1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com