A1BG (alpha-1-B Glycoprotein, A1BG)

Short Description: The protein encoded by this gene is a plasma glycoprotein of unknown function. The protein shows sequence similarity to the variable regions of some immunoglobulin supergene family member proteins. [provided by RefSeq, Jul 2008].
More information related to gene A1BG.
Products related to A1BG Gene:
119 Products
  • 113
  • 6
  • 48
  • 40
  • 29
  • 2
  • 74
  • 27
  • 20
  • 16
Fusion tag
  • 36
  • 16
  • 13
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
  • 52
  • 36
  • 12
  • 9
  • 2
  • 41
  • 35
  • 21
  • 8
  • 6
  • 6
Resistance Gene
  • 55
  • 38
  • 18
  • 2
  • 2
Expression Type
  • 87
  • 50
  • 22
Selectable Marker
  • 26
  • 26
  • 22
  • 1
  • 34
  • 31
  • 31
  • 12
  • 8
  • 60
  • 24
  • 22
  • 13
Supplier: Log in to see

Protein Expression, Cloning
alpha-1-B Glycoprotein (A1BG)
Gene ID:
140656 (Rat (Rattus), A1BG)
A1BG, A1bg
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4048127
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
alpha-1-B Glycoprotein (A1BG)
Gene ID:
518955 (Cow (Bovine), A1BG)
A1BG, A1bg
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3860187
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
alpha-1-B Glycoprotein (A1BG)
Gene ID:
1 (Human, A1BG)
A1BG, A1bg
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3470800
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

alpha-1-B Glycoprotein (A1BG)
NCBI Accession:
A1BG, A1bg
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3545817
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

alpha-1-B Glycoprotein (A1BG)
NCBI Accession:
Mouse (Murine)
A1BG, A1bg
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3545818
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Protein Expression, Cloning
alpha-1-B Glycoprotein (A1BG)
Gene ID:
1 (Human, A1BG)
A1BG, A1bg
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3470799
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
alpha-1-B Glycoprotein (A1BG)
Gene ID:
518955 (Cow (Bovine), A1BG)
A1BG, A1bg
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3860185
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
alpha-1-B Glycoprotein (A1BG)
Gene ID:
140656 (Rat (Rattus), A1BG)
A1BG, A1bg
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4048128
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

alpha-1-B Glycoprotein (A1BG)
A1BG, A1bg
Insert length:
1122 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4372089
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Protein Expression
alpha-1-B Glycoprotein (A1BG)
A1BG, A1bg
Insert length:
1122 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4372520
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Protein Expression
alpha-1-B Glycoprotein (A1BG)
A1BG, A1bg
Insert length:
1122 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4432717
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

alpha-1-B Glycoprotein (A1BG)
A1BG, A1bg
Insert length:
1122 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4825876
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

alpha-1-B Glycoprotein (A1BG)
A1BG, A1bg
Insert length:
1122 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4757997
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

alpha-1-B Glycoprotein (A1BG)
A1BG, A1bg
Insert length:
1122 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4696747
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Protein Expression
alpha-1-B Glycoprotein (A1BG)
Gene ID:
117586 (Mouse (Murine), A1BG)
A1BG, A1bg
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3406802
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression
alpha-1-B Glycoprotein (A1BG)
Gene ID:
1 (Human, A1BG)
A1BG, A1bg
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3411913
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression
alpha-1-B Glycoprotein (A1BG)
NCBI Accession:
A1BG, A1bg
Insert length:
1488 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5333721
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

RNA Interference
alpha-1-B Glycoprotein
A1B, ABG, GAB, HYST2477, A1BG, C44
HPLC purified
Available with shipment
  • A1BG (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3262495
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
Supplier: Log in to see

RNA Interference
alpha-1-B Glycoprotein
Rat (Rattus)
A1B, ABG, GAB, HYST2477, A1BG, C44
HPLC purified
Available with shipment
  • A1bg (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3356053
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Genome Editing with Engineered Nucleases, Protein Expression
alpha-1-B Glycoprotein (A1BG)
NCBI Accession:
A1BG, A1bg
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of A1BG
Viral Particles
-80 °C
Catalog No. ABIN5082404
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
  • <
  • 1

Synonyms and alternative names related to A1BG

  • alpha-1-B glycoprotein (A1BG)
  • alpha-1-B glycoprotein (A1bg)
  • A1B
  • A1BG
  • ABG
  • C44
  • GAB
  • HYST2477

Gene-IDs for different species

1 Homo sapiens
742390 Pan troglodytes
117586 Mus musculus
140656 Rattus norvegicus
484230 Canis lupus familiaris
518955 Bos taurus
712737 Macaca mulatta
100400383 Callithrix jacchus
100438958 Pongo abelii
100516980 Sus scrofa
100354232 Oryctolagus cuniculus
100064369 Equus caballus
106846642 Equus asinus
101119665 Ovis aries

Protein level used designations for A1BG

  • alpha-1B-glycoprotein
  • alpha-1-B glycoprotein
  • alpha 1B-glycoprotein
  • liver regeneration-related protein 1
  • alpha-1B-glycoprotein-like
  • LOW QUALITY PROTEIN: alpha-1B-glycoprotein
Other products related to A1BG such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com