A1BG (alpha-1-B Glycoprotein, A1BG)

Short Description: The protein encoded by this gene is a plasma glycoprotein of unknown function. The protein shows sequence similarity to the variable regions of some immunoglobulin supergene family member proteins. [provided by RefSeq, Jul 2008].
More information related to gene A1BG.
Products related to A1BG Gene:
119 Products
Type
  • 113
  • 6
Species
  • 48
  • 40
  • 29
  • 2
Application
  • 74
  • 27
  • 20
  • 16
Fusion tag
  • 36
  • 16
  • 13
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 52
  • 36
  • 12
  • 9
  • 2
Insert
  • 41
  • 35
  • 21
  • 8
  • 6
Oligo-Type
  • 6
Resistance Gene
  • 55
  • 38
  • 18
  • 2
  • 2
Expression Type
  • 87
  • 50
  • 22
Selectable Marker
  • 26
  • 26
  • 22
  • 1
Promoter
  • 34
  • 31
  • 31
  • 12
  • 8
Format
  • 60
  • 24
  • 22
  • 13
Supplier: Log in to see

Full length Rattus norvegicus alpha-1-B glycoprotein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha-1-B Glycoprotein (A1BG)
Gene ID:
140656 (Rat (Rattus), A1BG)
Synonyms:
A1BG, A1bg
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048127
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Bos taurus alpha-1-B glycoprotein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha-1-B Glycoprotein (A1BG)
Gene ID:
518955 (Cow (Bovine), A1BG)
Synonyms:
A1BG, A1bg
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3860187
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens alpha-1-B glycoprotein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha-1-B Glycoprotein (A1BG)
Gene ID:
1 (Human, A1BG)
Synonyms:
A1BG, A1bg
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3470800
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens alpha-1-B glycoprotein.

Type:
cDNA
Application:
Cloning
Gene:
alpha-1-B Glycoprotein (A1BG)
NCBI Accession:
NM_130786
Species:
Human
Synonyms:
A1BG, A1bg
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545817
$125.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Mus musculus alpha-1-B glycoprotein

Type:
cDNA
Application:
Cloning
Gene:
alpha-1-B Glycoprotein (A1BG)
NCBI Accession:
NM_001081067
Species:
Mouse (Murine)
Synonyms:
A1BG, A1bg
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545818
$125.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Rattus norvegicus alpha-1-B glycoprotein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha-1-B Glycoprotein (A1BG)
Gene ID:
140656 (Rat (Rattus), A1BG)
Synonyms:
A1BG, A1bg
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048128
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Bos taurus alpha-1-B glycoprotein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha-1-B Glycoprotein (A1BG)
Gene ID:
518955 (Cow (Bovine), A1BG)
Synonyms:
A1BG, A1bg
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3860185
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens alpha-1-B glycoprotein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha-1-B Glycoprotein (A1BG)
Gene ID:
1 (Human, A1BG)
Synonyms:
A1BG, A1bg
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3470799
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Bacterial expression of Human A1BG with His tag

Type:
cDNA
Application:
Cloning
Gene:
alpha-1-B Glycoprotein (A1BG)
Species:
Human
Synonyms:
A1BG, A1bg
Insert length:
1122 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4372089
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Human A1BG with HA tag

Type:
cDNA
Application:
Protein Expression
Gene:
alpha-1-B Glycoprotein (A1BG)
Species:
Human
Synonyms:
A1BG, A1bg
Insert length:
1122 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4372520
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Human A1BG with His tag

Type:
cDNA
Application:
Protein Expression
Gene:
alpha-1-B Glycoprotein (A1BG)
Species:
Human
Synonyms:
A1BG, A1bg
Insert length:
1122 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4432717
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human A1BG with His-GST

Type:
cDNA
Application:
Cloning
Gene:
alpha-1-B Glycoprotein (A1BG)
Species:
Human
Synonyms:
A1BG, A1bg
Insert length:
1122 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4825876
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human A1BG with His tag

Type:
cDNA
Application:
Cloning
Gene:
alpha-1-B Glycoprotein (A1BG)
Species:
Human
Synonyms:
A1BG, A1bg
Insert length:
1122 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4757997
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human A1BG with His-MBP

Type:
cDNA
Application:
Cloning
Gene:
alpha-1-B Glycoprotein (A1BG)
Species:
Human
Synonyms:
A1BG, A1bg
Insert length:
1122 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4696747
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

The alpha-1-B glycoprotein ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Type:
ORF
Application:
Protein Expression
Gene:
alpha-1-B Glycoprotein (A1BG)
Gene ID:
117586 (Mouse (Murine), A1BG)
Synonyms:
A1BG, A1bg
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3406802
$300.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

The alpha-1-B glycoprotein ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Type:
ORF
Application:
Protein Expression
Gene:
alpha-1-B Glycoprotein (A1BG)
Gene ID:
1 (Human, A1BG)
Synonyms:
A1BG, A1bg
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3411913
$300.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human alpha-1-B glycoprotein (A1BG)

Type:
ORF
Application:
Protein Expression
Gene:
alpha-1-B Glycoprotein (A1BG)
NCBI Accession:
NM_130786,NP_570602
Species:
Human
Synonyms:
A1BG, A1bg
Insert length:
1488 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5333721
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Individual gRNA against A1BG in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
alpha-1-B Glycoprotein (A1BG)
NCBI Accession:
NM_130786
Species:
Human
Synonyms:
A1BG, A1bg
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of A1BG
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5082404
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Individual gRNA against A1bg in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
alpha-1-B Glycoprotein (A1BG)
NCBI Accession:
NM_022258
Species:
Rat (Rattus)
Synonyms:
A1BG, A1bg
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of A1bg
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5082408
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Individual gRNA against A1bg in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
alpha-1-B Glycoprotein (A1BG)
NCBI Accession:
NM_001081067
Species:
Mouse (Murine)
Synonyms:
A1BG, A1bg
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of A1bg
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5082406
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to A1BG

  • alpha-1-B glycoprotein (A1BG)
  • alpha-1-B glycoprotein (A1bg)
  • A1B
  • A1BG
  • ABG
  • C44
  • GAB
  • HYST2477

Gene-IDs for different species

GENE IDSPECIES
1 Homo sapiens
742390 Pan troglodytes
117586 Mus musculus
140656 Rattus norvegicus
484230 Canis lupus familiaris
518955 Bos taurus
712737 Macaca mulatta
100400383 Callithrix jacchus
100438958 Pongo abelii
100516980 Sus scrofa
100354232 Oryctolagus cuniculus
100064369 Equus caballus
106846642 Equus asinus
101119665 Ovis aries

Protein level used designations for A1BG

  • alpha-1B-glycoprotein
  • alpha-1-B glycoprotein
  • alpha 1B-glycoprotein
  • liver regeneration-related protein 1
  • alpha-1B-glycoprotein-like
  • LOW QUALITY PROTEIN: alpha-1B-glycoprotein
Other products related to A1BG such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com