A4GALT (alpha 1, 4-Galactosyltransferase, A4GALT)

Short Description: The protein encoded by this gene catalyzes the transfer of galactose to lactosylceramide to form globotriaosylceramide, which has been identified as the P(k) antigen of the P blood group system. The encoded protein, which is a type II membrane protein found in the Golgi, is also required for the synthesis of the bacterial verotoxins receptor. [provided by RefSeq, Jul 2008].
More information related to gene A4GALT.
Products related to A4GALT Gene:
140 Products
Type
  • 133
  • 7
Species
  • 57
  • 54
  • 29
Oligo-Type
  • 5
  • 2
Insert
  • 49
  • 47
  • 21
  • 8
  • 6
Vector
  • 58
  • 40
  • 16
  • 9
  • 4
Vector Backbone
  • 8
  • 8
  • 6
  • 6
  • 6
Fusion tag
  • 45
  • 18
  • 16
  • 12
  • 8
Resistance Gene
  • 65
  • 44
  • 22
  • 2
  • 2
Selectable Marker
  • 34
  • 26
  • 22
  • 1
Promoter
  • 39
  • 36
  • 31
  • 18
  • 8
Expression Type
  • 101
  • 54
  • 22
Application
  • 85
  • 29
  • 26
  • 16
  • 2
Format
  • 66
  • 32
  • 24
  • 18
Supplier: Log in to see

Full length Clone DNA of Homo sapiens alpha 1,4-galactosyltransferase.

Type:
cDNA
Application:
Cloning
Gene:
alpha 1, 4-Galactosyltransferase (A4GALT)
Species:
Human
Synonyms:
A4GALT, A4galt
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545820
€66.37
1 vial
Plus shipping costs €45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Mus musculus alpha 1,4-galactosyltransferase.

Type:
cDNA
Application:
Cloning
Gene:
alpha 1, 4-Galactosyltransferase (A4GALT)
NCBI Accession:
NM_001004150
Species:
Mouse (Murine)
Synonyms:
A4GALT, A4galt
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545821
€66.37
1 vial
Plus shipping costs €45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Verified forward and reverse primers for analyzing the quantitative expression of gene

Application:
Quantitative real-time PCR
Gene:
alpha 1, 4-Galactosyltransferase
Species:
Mouse (Murine)
Synonyms:
A14GALT, A4GALT1, Gb3S, P(k), P1, P1PK, PK, Gb3
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194264
€69.91
1 vial
Plus shipping costs €45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Verified forward and reverse primers for analyzing the quantitative expression of gene

Application:
Quantitative real-time PCR
Gene:
alpha 1, 4-Galactosyltransferase
Species:
Human
Synonyms:
A14GALT, A4GALT1, Gb3S, P(k), P1, P1PK, PK, Gb3
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3191166
€69.91
1 vial
Plus shipping costs €45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Full length Homo sapiens alpha 1,4-galactosyltransferase cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha 1, 4-Galactosyltransferase (A4GALT)
Gene ID:
53947 (Human, A4GALT)
Synonyms:
A4GALT, A4galt
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3815327
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens alpha 1,4-galactosyltransferase cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha 1, 4-Galactosyltransferase (A4GALT)
Gene ID:
53947 (Human, A4GALT)
Synonyms:
A4GALT, A4galt
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3815326
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Rattus norvegicus alpha 1,4-galactosyltransferase cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha 1, 4-Galactosyltransferase (A4GALT)
Gene ID:
63888 (Rat (Rattus), A4GALT)
Synonyms:
A4GALT, A4galt
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4046829
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus alpha 1,4-galactosyltransferase cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
alpha 1, 4-Galactosyltransferase (A4GALT)
Gene ID:
239559 (Mouse (Murine), A4GALT)
Synonyms:
A4GALT, A4galt
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4014089
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus alpha 1,4-galactosyltransferase cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
alpha 1, 4-Galactosyltransferase (A4GALT)
Gene ID:
239559 (Mouse (Murine), A4GALT)
Synonyms:
A4GALT, A4galt
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4014090
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens alpha 1,4-galactosyltransferase cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha 1, 4-Galactosyltransferase (A4GALT)
Gene ID:
53947 (Human, A4GALT)
Synonyms:
A4GALT, A4galt
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3815328
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus alpha 1,4-galactosyltransferase cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
alpha 1, 4-Galactosyltransferase (A4GALT)
Gene ID:
239559 (Mouse (Murine), A4GALT)
Synonyms:
A4GALT, A4galt
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4014087
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens alpha 1,4-galactosyltransferase cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha 1, 4-Galactosyltransferase (A4GALT)
Gene ID:
53947 (Human, A4GALT)
Synonyms:
A4GALT, A4galt
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3815325
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus alpha 1,4-galactosyltransferase cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
alpha 1, 4-Galactosyltransferase (A4GALT)
Gene ID:
239559 (Mouse (Murine), A4GALT)
Synonyms:
A4GALT, A4galt
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4014088
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Rattus norvegicus alpha 1,4-galactosyltransferase cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha 1, 4-Galactosyltransferase (A4GALT)
Gene ID:
63888 (Rat (Rattus), A4GALT)
Synonyms:
A4GALT, A4galt
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4046830
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human A4GALT is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
alpha 1, 4-Galactosyltransferase (A4GALT)
NCBI Accession:
NM_017436,NP_059132
Species:
Human
Synonyms:
A4GALT, A4galt
Insert length:
2000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3380837
€168.14
10 μg
Plus shipping costs €45.00
Delivery in 8 to 11 Business Days
Supplier: Log in to see

Full length Clone DNA of Mus musculus alpha 1,4-galactosyltransferase with C terminal Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
alpha 1, 4-Galactosyltransferase (A4GALT)
NCBI Accession:
NM_001004150
Species:
Mouse (Murine)
Synonyms:
A4GALT, A4galt
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3610018
€172.57
1 vial
Plus shipping costs €45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens alpha 1,4-galactosyltransferase with N terminal His tag.

Type:
ORF
Application:
Protein Expression
Gene:
alpha 1, 4-Galactosyltransferase (A4GALT)
Species:
Human
Synonyms:
A4GALT, A4galt
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948173

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3610033
€172.57
1 vial
Plus shipping costs €45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens alpha 1,4-galactosyltransferase with N terminal Myc tag.

Type:
ORF
Application:
Protein Expression
Gene:
alpha 1, 4-Galactosyltransferase (A4GALT)
Species:
Human
Synonyms:
A4GALT, A4galt
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948172

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3610035
€172.57
1 vial
Plus shipping costs €45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Full length Clone DNA of Mus musculus alpha 1,4-galactosyltransferase with N terminal Myc tag.

Type:
ORF
Application:
Protein Expression
Gene:
alpha 1, 4-Galactosyltransferase (A4GALT)
NCBI Accession:
NM_001004150
Species:
Mouse (Murine)
Synonyms:
A4GALT, A4galt
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948172

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3610036
€172.57
1 vial
Plus shipping costs €45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Full length Clone DNA of Mus musculus alpha 1,4-galactosyltransferase with N terminal Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
alpha 1, 4-Galactosyltransferase (A4GALT)
NCBI Accession:
NM_001004150
Species:
Mouse (Murine)
Synonyms:
A4GALT, A4galt
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948170

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3610030
€172.57
1 vial
Plus shipping costs €45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to A4GALT

  • alpha 1,4-galactosyltransferase (P blood group) (A4GALT)
  • alpha 1,4-galactosyltransferase (A4galt)
  • alpha 1,4-galactosyltransferase (A4GALT)
  • alpha 1,4-galactosyltransferase (P blood group) (A4galt)
  • A4GALT1
  • A14GALT
  • Gb3
  • Gb3S
  • P(k)
  • P1
  • P1PK
  • PK

Gene-IDs for different species

GENE IDSPECIES
53947 Homo sapiens
63888 Rattus norvegicus
239559 Mus musculus
418223 Gallus gallus
481222 Canis lupus familiaris
470230 Pan troglodytes
100721247 Cavia porcellus
618369 Bos taurus

Protein level used designations for A4GALT

  • CD77 synthase
  • GB3 synthase
  • P blood group (P one antigen)
  • P(k) antigen synthase
  • P1/Pk synthase
  • UDP-galactose:beta-D-galactosyl-beta1-R 4-alpha-D-galactosyltransferase
  • alpha-1,4-N-acetylglucosaminyltransferase
  • alpha4Gal-T1
  • globotriaosylceramide synthase
  • lactosylceramide 4-alpha-galactosyltransferase
  • Gb3 synthase
  • alpha-1,4-galactosyltransferase
  • Gb3/CD77 synthase
  • alpha 1,4-galactosyltransferase (globotriaosylceramide synthase)
  • alpha 1,4-galactosyltransferase (globotriaosylceramide synthase, P blood group)
  • gb3 synthase
Other products related to A4GALT such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com