AADACL2 (Arylacetamide Deacetylase-Like 2, AADACL2)

Products related to AADACL2 Gene:
88 Products
Type
  • 85
  • 3
Species
  • 41
  • 30
  • 17
Oligo-Type
  • 3
Insert
  • 35
  • 19
  • 15
  • 8
  • 6
Vector
  • 30
  • 26
  • 12
  • 9
  • 6
Vector Backbone
  • 7
  • 6
  • 6
  • 6
  • 4
Fusion tag
  • 33
  • 11
  • 9
  • 9
  • 8
Resistance Gene
  • 34
  • 32
  • 14
  • 5
  • 2
Selectable Marker
  • 31
  • 22
Promoter
  • 27
  • 25
  • 12
  • 8
  • 7
Expression Type
  • 77
  • 45
Application
  • 44
  • 22
  • 18
  • 16
Format
  • 30
  • 27
  • 20
  • 11
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
Arylacetamide Deacetylase-Like 2 (AADACL2)
Species:
Human
Synonyms:
Aadacl2, AADACL2
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5748763
€39.82
1 μg
Plus shipping costs €45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Full length Mus musculus arylacetamide deacetylase-like 2 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Arylacetamide Deacetylase-Like 2 (AADACL2)
Gene ID:
639634 (Mouse (Murine), AADACL2)
Synonyms:
Aadacl2, AADACL2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4024313
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus arylacetamide deacetylase-like 2 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Arylacetamide Deacetylase-Like 2 (AADACL2)
Gene ID:
639634 (Mouse (Murine), AADACL2)
Synonyms:
Aadacl2, AADACL2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4024314
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens arylacetamide deacetylase-like 2 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Arylacetamide Deacetylase-Like 2 (AADACL2)
Gene ID:
344752 (Human, AADACL2)
Synonyms:
Aadacl2, AADACL2
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4040690
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus arylacetamide deacetylase-like 2 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Arylacetamide Deacetylase-Like 2 (AADACL2)
Gene ID:
639634 (Mouse (Murine), AADACL2)
Synonyms:
Aadacl2, AADACL2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4024312
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus arylacetamide deacetylase-like 2 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Arylacetamide Deacetylase-Like 2 (AADACL2)
Gene ID:
639634 (Mouse (Murine), AADACL2)
Synonyms:
Aadacl2, AADACL2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4024311
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens arylacetamide deacetylase-like 2 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Arylacetamide Deacetylase-Like 2 (AADACL2)
Gene ID:
344752 (Human, AADACL2)
Synonyms:
Aadacl2, AADACL2
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4040691
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

Type:
ORF
Application:
Cloning
Gene:
Arylacetamide Deacetylase-Like 2 (AADACL2)
Gene ID:
344752 (Human, AADACL2)
Synonyms:
Aadacl2, AADACL2
Insert length:
1140 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5322564
€172.15
2 μg
Plus shipping costs €45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Bacterial expression of Human AADACL2 with His tag

Type:
cDNA
Application:
Cloning
Gene:
Arylacetamide Deacetylase-Like 2 (AADACL2)
Species:
Human
Synonyms:
Aadacl2, AADACL2
Insert length:
1140 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4372097
€243.36
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Human AADACL2 with His tag

Type:
cDNA
Application:
Protein Expression
Gene:
Arylacetamide Deacetylase-Like 2 (AADACL2)
Species:
Human
Synonyms:
Aadacl2, AADACL2
Insert length:
1140 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4432725
€243.36
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human AADACL2 with His tag

Type:
cDNA
Application:
Cloning
Gene:
Arylacetamide Deacetylase-Like 2 (AADACL2)
Species:
Human
Synonyms:
Aadacl2, AADACL2
Insert length:
1140 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4758005
€243.36
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human AADACL2 with His-GST

Type:
cDNA
Application:
Cloning
Gene:
Arylacetamide Deacetylase-Like 2 (AADACL2)
Species:
Human
Synonyms:
Aadacl2, AADACL2
Insert length:
1140 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4825886
€243.36
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Human AADACL2 with HA tag

Type:
cDNA
Application:
Protein Expression
Gene:
Arylacetamide Deacetylase-Like 2 (AADACL2)
Species:
Human
Synonyms:
Aadacl2, AADACL2
Insert length:
1140 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4372528
€243.36
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human AADACL2 with His-MBP

Type:
cDNA
Application:
Cloning
Gene:
Arylacetamide Deacetylase-Like 2 (AADACL2)
Species:
Human
Synonyms:
Aadacl2, AADACL2
Insert length:
1140 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4696757
€243.36
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

The arylacetamide deacetylase-like 2 ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Type:
ORF
Application:
Protein Expression
Gene:
Arylacetamide Deacetylase-Like 2 (AADACL2)
Gene ID:
344752 (Human, AADACL2)
Synonyms:
Aadacl2, AADACL2
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3428925
€265.49
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Rat Aadacl2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Arylacetamide Deacetylase-Like 2 (AADACL2)
NCBI Accession:
NM_001191706,NP_001178635
Species:
Rat (Rattus)
Synonyms:
Aadacl2, AADACL2
Insert length:
1206 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308232
€327.43
10 μg
Plus shipping costs €45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Aadacl2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Arylacetamide Deacetylase-Like 2 (AADACL2)
NCBI Accession:
NM_001128091,NP_001121563
Species:
Mouse (Murine)
Synonyms:
Aadacl2, AADACL2
Insert length:
1206 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308231
€345.13
10 μg
Plus shipping costs €45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

Application:
RNA Interference
Gene:
Arylacetamide Deacetylase-Like 2
Species:
Mouse (Murine)
Synonyms:
EG639634, RGD1563197
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Aadacl2 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3269465
€345.13
1 kit
Plus shipping costs €45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

Application:
RNA Interference
Gene:
Arylacetamide Deacetylase-Like 2
Species:
Human
Synonyms:
EG639634, RGD1563197
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • AADACL2 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3314611
€345.13
1 kit
Plus shipping costs €45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Individual gRNA against Aadacl2 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Arylacetamide Deacetylase-Like 2 (AADACL2)
NCBI Accession:
NM_001128091
Species:
Mouse (Murine)
Synonyms:
Aadacl2, AADACL2
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Aadacl2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5134582
€349.56
300 μL
Plus shipping costs €45.00 and €20.00 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to AADACL2

  • arylacetamide deacetylase like 2 (Aadacl2)
  • arylacetamide deacetylase-like 2 (Aadacl2)
  • arylacetamide deacetylase like 2 (AADACL2)
  • EG639634
  • RGD1563197

Gene-IDs for different species

GENE IDSPECIES
639634 Mus musculus
295076 Rattus norvegicus
344752 Homo sapiens

Protein level used designations for AADACL2

Other products related to AADACL2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com