AAMDC (Adipogenesis Associated Mth938 Domain Containing, AAMDC)

Products related to AAMDC Gene:
143 Products
  • 137
  • 6
  • 67
  • 56
  • 20
  • 5
  • 1
  • 63
  • 42
  • 16
  • 8
  • 6
  • 52
  • 34
  • 28
  • 9
  • 8
Vector Backbone
  • 7
  • 7
  • 7
  • 7
  • 7
Fusion tag
  • 40
  • 23
  • 16
  • 10
  • 9
Resistance Gene
  • 75
  • 29
  • 22
  • 11
  • 2
Selectable Marker
  • 40
  • 22
  • 13
  • 1
  • 47
  • 30
  • 28
  • 20
  • 8
Expression Type
  • 116
  • 62
  • 13
  • 78
  • 41
  • 21
  • 16
  • 1
  • 62
  • 45
  • 26
  • 10
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Adipogenesis Associated Mth938 Domain Containing (AAMDC)
AAMDC, aamdc, Aamdc
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5734103
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Adipogenesis Associated Mth938 Domain Containing (AAMDC)
AAMDC, aamdc, Aamdc
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5734104
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens adipogenesis associated, Mth938 domain containing.

Adipogenesis Associated Mth938 Domain Containing (AAMDC)
AAMDC, aamdc, Aamdc
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3545831
1 vial
Plus shipping costs €45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Verified forward and reverse primers for analyzing the quantitative expression of gene

Quantitative real-time PCR
Adipogenesis Associated Mth938 Domain Containing
C11orf67, C29H11orf67, c11orf67, zgc:112239, CK067, RGD1561459, 1810020D17Rik, 1810037D19Rik, LI2
-20 °C
Catalog No. ABIN3191942
1 vial
Plus shipping costs €45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human chromosome 11 open reading frame 67 (C11orf67)

Protein Expression
Adipogenesis Associated Mth938 Domain Containing (AAMDC)
NCBI Accession:
AAMDC, aamdc, Aamdc
Insert length:
369 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5380496
10 μg
Plus shipping costs €45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Full length Homo sapiens chromosome 11 open reading frame 67 cDNA clone.

Protein Expression, Cloning
Adipogenesis Associated Mth938 Domain Containing (AAMDC)
Gene ID:
28971 (Human, AAMDC)
AAMDC, aamdc, Aamdc
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3813332
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens chromosome 11 open reading frame 67 cDNA clone.

Adipogenesis Associated Mth938 Domain Containing (AAMDC)
Gene ID:
28971 (Human, AAMDC)
AAMDC, aamdc, Aamdc
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4090460
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens chromosome 11 open reading frame 67 cDNA clone.

Protein Expression, Cloning
Adipogenesis Associated Mth938 Domain Containing (AAMDC)
Gene ID:
28971 (Human, AAMDC)
AAMDC, aamdc, Aamdc
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3813330
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens chromosome 11 open reading frame 67 cDNA clone.

Adipogenesis Associated Mth938 Domain Containing (AAMDC)
Gene ID:
28971 (Human, AAMDC)
AAMDC, aamdc, Aamdc
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4090459
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

Adipogenesis Associated Mth938 Domain Containing (AAMDC)
Gene ID:
28971 (Human, AAMDC)
AAMDC, aamdc, Aamdc
Insert length:
267 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5311575
2 μg
Plus shipping costs €45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

Adipogenesis Associated Mth938 Domain Containing (AAMDC)
Gene ID:
28971 (Human, AAMDC)
AAMDC, aamdc, Aamdc
Insert length:
369 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5318118
2 μg
Plus shipping costs €45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Bacterial expression of Human C11orf67 with His-MBP

Adipogenesis Associated Mth938 Domain Containing (AAMDC)
AAMDC, aamdc, Aamdc
Insert length:
369 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4698352
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human C11orf67 with His-MBP

Adipogenesis Associated Mth938 Domain Containing (AAMDC)
AAMDC, aamdc, Aamdc
Insert length:
267 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4698353
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human C11orf67 with His tag

Adipogenesis Associated Mth938 Domain Containing (AAMDC)
AAMDC, aamdc, Aamdc
Insert length:
267 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4759175
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human C11orf67 with His tag

Adipogenesis Associated Mth938 Domain Containing (AAMDC)
AAMDC, aamdc, Aamdc
Insert length:
267 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4759176
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human C11orf67 with His tag

Adipogenesis Associated Mth938 Domain Containing (AAMDC)
AAMDC, aamdc, Aamdc
Insert length:
267 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4764468
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human C11orf67 with His tag

Adipogenesis Associated Mth938 Domain Containing (AAMDC)
AAMDC, aamdc, Aamdc
Insert length:
267 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4764469
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human C11orf67 with His-GST

Adipogenesis Associated Mth938 Domain Containing (AAMDC)
AAMDC, aamdc, Aamdc
Insert length:
369 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4827481
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human C11orf67 with His-GST

Adipogenesis Associated Mth938 Domain Containing (AAMDC)
AAMDC, aamdc, Aamdc
Insert length:
267 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4827482
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Human C11orf67 with His tag

Protein Expression
Adipogenesis Associated Mth938 Domain Containing (AAMDC)
AAMDC, aamdc, Aamdc
Insert length:
267 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4433895
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to AAMDC

  • adipogenesis associated Mth938 domain containing (AAMDC)
  • adipogenesis associated, Mth938 domain containing (aamdc)
  • adipogenesis associated, Mth938 domain containing (Aamdc)
  • adipogenesis associated Mth938 domain containing (Aamdc)
  • 1810020D17Rik
  • 1810037D19Rik
  • C11orf67
  • c11orf67
  • C29H11orf67
  • CK067
  • LI2
  • RGD1561459
  • zgc:112239

Gene-IDs for different species

533224 Bos taurus
553802 Danio rerio
28971 Homo sapiens
361606 Rattus norvegicus
66273 Mus musculus
100713364 Cavia porcellus

Protein level used designations for AAMDC

  • UPF0366 protein C11orf67 homolog
  • mth938 domain-containing protein
  • UPF0366 protein C11orf67
  • adipogenesis associated Mth938 domain-containing protein
Other products related to AAMDC such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com