AANAT (Aralkylamine N-Acetyltransferase, AANAT)

Short Description: The protein encoded by this gene belongs to the acetyltransferase superfamily. It is the penultimate enzyme in melatonin synthesis and controls the night/day rhythm in melatonin production in the vertebrate pineal gland. Melatonin is essential for the function of the circadian clock that influences activity and sleep. This enzyme is regulated by cAMP-dependent phosphorylation that promotes its interaction with 14-3-3 proteins and thus protects the enzyme against proteasomal degradation. This gene may contribute to numerous genetic diseases such as delayed sleep phase syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009].
More information related to gene AANAT.
Products related to AANAT Gene:
114 Products
Type
  • 109
  • 5
Species
  • 49
  • 32
  • 28
  • 3
  • 2
Oligo-Type
  • 5
Insert
  • 45
  • 27
  • 21
  • 8
  • 6
Vector
  • 38
  • 32
  • 16
  • 12
  • 9
Vector Backbone
  • 8
  • 7
  • 7
  • 6
  • 6
Fusion tag
  • 46
  • 18
  • 12
  • 9
  • 8
Resistance Gene
  • 47
  • 35
  • 22
  • 5
  • 2
Selectable Marker
  • 35
  • 26
  • 1
Promoter
  • 36
  • 31
  • 14
  • 11
  • 8
Expression Type
  • 94
  • 52
Application
  • 55
  • 33
  • 26
  • 16
Format
  • 42
  • 27
  • 23
  • 22
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
Aralkylamine N-Acetyltransferase (AANAT)
Species:
Human
Synonyms:
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5758106
€39.82
1 μg
Plus shipping costs €45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human aralkylamine N-acetyltransferase (AANAT) transcript variant 2

Type:
ORF
Application:
Protein Expression
Gene:
Aralkylamine N-Acetyltransferase (AANAT)
NCBI Accession:
NM_001088,NP_001079
Species:
Human
Synonyms:
AANAT, Aanat
Insert length:
624 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5458903
€86.73
10 μg
Plus shipping costs €45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Full length Danio rerio arylalkylamine N-acetyltransferase cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
30685 (Zebrafish (Danio rerio), AANAT)
Synonyms:
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4037345
€87.61
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Danio rerio arylalkylamine N-acetyltransferase cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
30685 (Zebrafish (Danio rerio), AANAT)
Synonyms:
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
pBluescript SK-
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3468462
€87.61
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens aralkylamine N-acetyltransferase cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
15 (Human, AANAT)
Synonyms:
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3462267
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens aralkylamine N-acetyltransferase cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
15 (Human, AANAT)
Synonyms:
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3462266
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus arylalkylamine N-acetyltransferase cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
11298 (Mouse (Murine), AANAT)
Synonyms:
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4001596
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus arylalkylamine N-acetyltransferase cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
11298 (Mouse (Murine), AANAT)
Synonyms:
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4001595
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens aralkylamine N-acetyltransferase cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
15 (Human, AANAT)
Synonyms:
AANAT, Aanat
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3875073
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus laevis arylalkylamine N-acetyltransferase cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
100335046 (Xenopus laevis, AANAT)
Synonyms:
AANAT, Aanat
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3985024
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens aralkylamine N-acetyltransferase cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
15 (Human, AANAT)
Synonyms:
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
pPCR-Script Amp SK+
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4095152
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Danio rerio arylalkylamine N-acetyltransferase cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
30685 (Zebrafish (Danio rerio), AANAT)
Synonyms:
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4037344
€123.01
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens aralkylamine N-acetyltransferase cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
15 (Human, AANAT)
Synonyms:
AANAT, Aanat
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3470816
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus arylalkylamine N-acetyltransferase cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
11298 (Mouse (Murine), AANAT)
Synonyms:
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4001597
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens aralkylamine N-acetyltransferase cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
15 (Human, AANAT)
Synonyms:
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3998305
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens aralkylamine N-acetyltransferase cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
15 (Human, AANAT)
Synonyms:
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3998306
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus arylalkylamine N-acetyltransferase cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
11298 (Mouse (Murine), AANAT)
Synonyms:
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4001594
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus laevis arylalkylamine N-acetyltransferase cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
100335046 (Xenopus laevis, AANAT)
Synonyms:
AANAT, Aanat
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3985023
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens aralkylamine N-acetyltransferase cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
15 (Human, AANAT)
Synonyms:
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
pPCR-Script Amp SK+
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4095151
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

Type:
ORF
Application:
Cloning
Gene:
Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
15 (Human, AANAT)
Synonyms:
AANAT, Aanat
Insert length:
624 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5321819
€163.24
2 μg
Plus shipping costs €45.00
Delivery in 15 to 17 Business Days
  • <
  • 1

Synonyms and alternative names related to AANAT

  • aralkylamine N-acetyltransferase (AANAT)
  • aralkylamine N-acetyltransferase (Aanat)
  • arylalkylamine N-acetyltransferase (Aanat)
  • AA-NAT
  • DSPS
  • Nat-2
  • Nat4
  • SNAT
  • Snat

Gene-IDs for different species

GENE IDSPECIES
15 Homo sapiens
25120 Rattus norvegicus
483331 Canis lupus familiaris
396066 Gallus gallus
443531 Ovis aries
706924 Macaca mulatta
503504 Pan troglodytes
11298 Mus musculus
281583 Bos taurus

Protein level used designations for AANAT

  • arylalkylamine N-acetyltransferase
  • serotonin N-acetyltransferase
  • serotonin acetylase
  • Arylalkylamine N - acetyltransferase (Serotonin N - acetyltransferase)
  • Seretonin N-acetyltransferase
  • arylakylamine N-acetyltransferase
  • AA-NAT
  • pineal serotonin N-acetyltransferase
  • pineal arylalkylamine N-acetyltransferase
  • aralkylamine N-acetyltransferase
Other products related to AANAT such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com