AANAT (Aralkylamine N-Acetyltransferase, AANAT)

Short Description: The protein encoded by this gene belongs to the acetyltransferase superfamily. It is the penultimate enzyme in melatonin synthesis and controls the night/day rhythm in melatonin production in the vertebrate pineal gland. Melatonin is essential for the function of the circadian clock that influences activity and sleep. This enzyme is regulated by cAMP-dependent phosphorylation that promotes its interaction with 14-3-3 proteins and thus protects the enzyme against proteasomal degradation. This gene may contribute to numerous genetic diseases such as delayed sleep phase syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009].
More information related to gene AANAT.
Products related to AANAT Gene:
114 Products
  • 109
  • 5
  • 49
  • 32
  • 28
  • 3
  • 2
  • 55
  • 33
  • 26
  • 16
Fusion tag
  • 46
  • 18
  • 12
  • 9
  • 8
Vector Backbone
  • 8
  • 7
  • 7
  • 6
  • 6
  • 38
  • 32
  • 16
  • 12
  • 9
  • 45
  • 27
  • 21
  • 8
  • 6
  • 5
Resistance Gene
  • 47
  • 35
  • 22
  • 5
  • 2
Expression Type
  • 94
  • 52
Selectable Marker
  • 35
  • 26
  • 1
  • 36
  • 31
  • 14
  • 11
  • 8
  • 42
  • 27
  • 23
  • 22
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Aralkylamine N-Acetyltransferase (AANAT)
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5758106
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human aralkylamine N-acetyltransferase (AANAT) transcript variant 2

Protein Expression
Aralkylamine N-Acetyltransferase (AANAT)
NCBI Accession:
AANAT, Aanat
Insert length:
624 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5458903
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Full length Danio rerio arylalkylamine N-acetyltransferase cDNA clone.

Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
30685 (Zebrafish (Danio rerio), AANAT)
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4037345
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Danio rerio arylalkylamine N-acetyltransferase cDNA clone.

Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
30685 (Zebrafish (Danio rerio), AANAT)
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
pBluescript SK-
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3468462
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus arylalkylamine N-acetyltransferase cDNA clone.

Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
11298 (Mouse (Murine), AANAT)
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4001596
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus laevis arylalkylamine N-acetyltransferase cDNA clone.

Protein Expression, Cloning
Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
100335046 (Xenopus laevis, AANAT)
AANAT, Aanat
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3985024
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus arylalkylamine N-acetyltransferase cDNA clone.

Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
11298 (Mouse (Murine), AANAT)
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4001595
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens aralkylamine N-acetyltransferase cDNA clone.

Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
15 (Human, AANAT)
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
pPCR-Script Amp SK+
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4095152
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens aralkylamine N-acetyltransferase cDNA clone.

Protein Expression, Cloning
Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
15 (Human, AANAT)
AANAT, Aanat
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3875073
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens aralkylamine N-acetyltransferase cDNA clone.

Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
15 (Human, AANAT)
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3462267
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens aralkylamine N-acetyltransferase cDNA clone.

Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
15 (Human, AANAT)
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3462266
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Danio rerio arylalkylamine N-acetyltransferase cDNA clone.

Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
30685 (Zebrafish (Danio rerio), AANAT)
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4037344
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus arylalkylamine N-acetyltransferase cDNA clone.

Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
11298 (Mouse (Murine), AANAT)
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4001597
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus laevis arylalkylamine N-acetyltransferase cDNA clone.

Protein Expression, Cloning
Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
100335046 (Xenopus laevis, AANAT)
AANAT, Aanat
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3985023
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens aralkylamine N-acetyltransferase cDNA clone.

Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
15 (Human, AANAT)
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3998306
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus arylalkylamine N-acetyltransferase cDNA clone.

Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
11298 (Mouse (Murine), AANAT)
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4001594
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens aralkylamine N-acetyltransferase cDNA clone.

Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
15 (Human, AANAT)
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
pPCR-Script Amp SK+
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4095151
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens aralkylamine N-acetyltransferase cDNA clone.

Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
15 (Human, AANAT)
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3998305
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens aralkylamine N-acetyltransferase cDNA clone.

Protein Expression, Cloning
Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
15 (Human, AANAT)
AANAT, Aanat
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3470816
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
15 (Human, AANAT)
AANAT, Aanat
Insert length:
624 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5321819
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
  • <
  • 1

Synonyms and alternative names related to AANAT

  • aralkylamine N-acetyltransferase (AANAT)
  • aralkylamine N-acetyltransferase (Aanat)
  • arylalkylamine N-acetyltransferase (Aanat)
  • AA-NAT
  • DSPS
  • Nat-2
  • Nat4
  • SNAT
  • Snat

Gene-IDs for different species

15 Homo sapiens
25120 Rattus norvegicus
483331 Canis lupus familiaris
396066 Gallus gallus
443531 Ovis aries
706924 Macaca mulatta
503504 Pan troglodytes
11298 Mus musculus
281583 Bos taurus

Protein level used designations for AANAT

  • arylalkylamine N-acetyltransferase
  • serotonin N-acetyltransferase
  • serotonin acetylase
  • Arylalkylamine N - acetyltransferase (Serotonin N - acetyltransferase)
  • Seretonin N-acetyltransferase
  • arylakylamine N-acetyltransferase
  • AA-NAT
  • pineal serotonin N-acetyltransferase
  • pineal arylalkylamine N-acetyltransferase
  • aralkylamine N-acetyltransferase
Other products related to AANAT such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com