AANAT (Aralkylamine N-Acetyltransferase, AANAT)

Short Description: The protein encoded by this gene belongs to the acetyltransferase superfamily. It is the penultimate enzyme in melatonin synthesis and controls the night/day rhythm in melatonin production in the vertebrate pineal gland. Melatonin is essential for the function of the circadian clock that influences activity and sleep. This enzyme is regulated by cAMP-dependent phosphorylation that promotes its interaction with 14-3-3 proteins and thus protects the enzyme against proteasomal degradation. This gene may contribute to numerous genetic diseases such as delayed sleep phase syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009].
More information related to gene AANAT.
Products related to AANAT Gene:
  • 99
  • 2
  • 43
  • 28
  • 26
  • 3
  • 1
  • 53
  • 26
  • 20
  • 16
Fusion tag
  • 36
  • 15
  • 12
  • 9
  • 8
Vector Backbone
  • 7
  • 7
  • 6
  • 6
  • 6
  • 38
  • 27
  • 12
  • 11
  • 9
  • 38
  • 27
  • 18
  • 8
  • 6
  • 2
Resistance Gene
  • 40
  • 32
  • 22
  • 5
  • 2
Expression Type
  • 89
  • 49
Selectable Marker
  • 28
  • 26
  • 1
  • 33
  • 28
  • 14
  • 9
  • 8
  • 36
  • 27
  • 22
  • 16
101 Products

Aralkylamine N-Acetyltransferase (AANAT)
AANAT, Aanat
Insert length:
624 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5758106
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression
Aralkylamine N-Acetyltransferase (AANAT)
NCBI Accession:
AANAT, Aanat
Insert length:
624 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5458903
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
30685 (Zebrafish (Danio rerio), AANAT)
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
pBluescript SK-
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3468462
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
30685 (Zebrafish (Danio rerio), AANAT)
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4037345
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
30685 (Zebrafish (Danio rerio), AANAT)
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4037344
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
15 (Human, AANAT)
AANAT, Aanat
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3470816
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
15 (Human, AANAT)
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3998305
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
15 (Human, AANAT)
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3998306
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
15 (Human, AANAT)
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
pPCR-Script Amp SK+
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4095151
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
100335046 (Xenopus laevis, AANAT)
AANAT, Aanat
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3985023
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
11298 (Mouse, AANAT)
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4001594
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
11298 (Mouse, AANAT)
AANAT, Aanat
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4001597
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
15 (Human, AANAT)
AANAT, Aanat
Insert length:
624 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5321819
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Aralkylamine N-Acetyltransferase (AANAT)
AANAT, Aanat
Insert length:
624 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4696761
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Aralkylamine N-Acetyltransferase (AANAT)
AANAT, Aanat
Insert length:
624 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4825890
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Aralkylamine N-Acetyltransferase (AANAT)
AANAT, Aanat
Insert length:
624 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4372101
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Aralkylamine N-Acetyltransferase (AANAT)
AANAT, Aanat
Insert length:
624 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4758009
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Aralkylamine N-Acetyltransferase (AANAT)
AANAT, Aanat
Insert length:
624 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4372532
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Aralkylamine N-Acetyltransferase (AANAT)
AANAT, Aanat
Insert length:
624 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4432729
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Aralkylamine N-Acetyltransferase (AANAT)
Gene ID:
15 (Human, AANAT)
AANAT, Aanat
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3429815
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to AANAT

  • aralkylamine N-acetyltransferase (AANAT)
  • aralkylamine N-acetyltransferase (Aanat)
  • arylalkylamine N-acetyltransferase (Aanat)
  • AA-NAT
  • DSPS
  • Nat-2
  • Nat4
  • SNAT
  • Snat

Gene-IDs for different species

15 Homo sapiens
25120 Rattus norvegicus
483331 Canis lupus familiaris
396066 Gallus gallus
443531 Ovis aries
706924 Macaca mulatta
503504 Pan troglodytes
11298 Mus musculus
281583 Bos taurus

Protein level used designations for AANAT

  • arylalkylamine N-acetyltransferase
  • serotonin N-acetyltransferase
  • serotonin acetylase
  • Arylalkylamine N - acetyltransferase (Serotonin N - acetyltransferase)
  • Seretonin N-acetyltransferase
  • arylakylamine N-acetyltransferase
  • AA-NAT
  • pineal serotonin N-acetyltransferase
  • pineal arylalkylamine N-acetyltransferase
  • aralkylamine N-acetyltransferase
Other products related to AANAT such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com