ABCA3 (ATP Binding Cassette Transporter A3, ABCA3)

Short Description: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The full transporter encoded by this gene may be involved in development of resistance to xenobiotics and engulfment during programmed cell death. [provided by RefSeq, Jul 2008].
More information related to gene ABCA3.
Products related to ABCA3 Gene:
93 Products
Type
  • 88
  • 5
Species
  • 52
  • 41
Application
  • 45
  • 25
  • 18
  • 12
  • 1
Fusion tag
  • 33
  • 11
  • 9
  • 7
  • 6
Vector Backbone
  • 5
  • 4
  • 4
  • 4
  • 4
Vector
  • 34
  • 23
  • 12
  • 11
  • 6
Insert
  • 37
  • 25
  • 14
  • 6
  • 4
Oligo-Type
  • 4
  • 1
Resistance Gene
  • 47
  • 27
  • 10
  • 4
  • 2
Expression Type
  • 67
  • 39
  • 11
Selectable Marker
  • 24
  • 18
  • 11
  • 4
  • 1
Promoter
  • 23
  • 22
  • 18
  • 12
  • 6
Format
  • 40
  • 27
  • 14
  • 12
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
ATP Binding Cassette Transporter A3 (ABCA3)
Species:
Human
Synonyms:
ABCA3, abcA3, LOC100380656, LOC100484901, Abca3, abca3b, LOC101115674
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5747905
$70.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Full length Homo sapiens ATP-binding cassette, sub-family A (ABC1), member 3 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ATP Binding Cassette Transporter A3 (ABCA3)
Gene ID:
21 (Human, ABCA3)
Synonyms:
ABCA3, abcA3, LOC100380656, LOC100484901, Abca3, abca3b, LOC101115674
Vector type:
Cloning Vector
Vector backbone:
pFLC1
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4071169
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens ATP-binding cassette, sub-family A (ABC1), member 3 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ATP Binding Cassette Transporter A3 (ABCA3)
Gene ID:
21 (Human, ABCA3)
Synonyms:
ABCA3, abcA3, LOC100380656, LOC100484901, Abca3, abca3b, LOC101115674
Vector type:
Cloning Vector
Vector backbone:
pCR-XL-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3996088
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens ATP-binding cassette, sub-family A (ABC1), member 3 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ATP Binding Cassette Transporter A3 (ABCA3)
Gene ID:
21 (Human, ABCA3)
Synonyms:
ABCA3, abcA3, LOC100380656, LOC100484901, Abca3, abca3b, LOC101115674
Vector type:
Cloning Vector
Vector backbone:
pCR-XL-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3996087
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus ATP-binding cassette, sub-family A (ABC1), member 3 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ATP Binding Cassette Transporter A3 (ABCA3)
Gene ID:
27410 (Mouse (Murine), ABCA3)
Synonyms:
ABCA3, abcA3, LOC100380656, LOC100484901, Abca3, abca3b, LOC101115674
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4100093
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens ATP-binding cassette, sub-family A (ABC1), member 3.

Type:
cDNA
Application:
Cloning
Gene:
ATP Binding Cassette Transporter A3 (ABCA3)
Species:
Human
Synonyms:
ABCA3, abcA3, LOC100380656, LOC100484901, Abca3, abca3b, LOC101115674
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545840
$125.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Verified forward and reverse primers for analyzing the quantitative expression of gene

Application:
Quantitative real-time PCR
Gene:
ATP Binding Cassette Transporter A3
Species:
Human
Synonyms:
DDBDRAFT_0201662, DDBDRAFT_0219856, DDB_0201662, DDB_0219856, ABC-C, ABC3, EST111653, LBM180, SMDP3, 1810036E22Rik, Abc3, abca3, si:ch211-155i15.6
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3192250
$129.00
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens ATP-binding cassette, sub-family A (ABC1), member 3 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ATP Binding Cassette Transporter A3 (ABCA3)
Gene ID:
21 (Human, ABCA3)
Synonyms:
ABCA3, abcA3, LOC100380656, LOC100484901, Abca3, abca3b, LOC101115674
Vector type:
Cloning Vector
Vector backbone:
pCR-XL-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3996085
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus ATP-binding cassette, sub-family A (ABC1), member 3 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ATP Binding Cassette Transporter A3 (ABCA3)
Gene ID:
27410 (Mouse (Murine), ABCA3)
Synonyms:
ABCA3, abcA3, LOC100380656, LOC100484901, Abca3, abca3b, LOC101115674
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4100092
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens ATP-binding cassette, sub-family A (ABC1), member 3 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ATP Binding Cassette Transporter A3 (ABCA3)
Gene ID:
21 (Human, ABCA3)
Synonyms:
ABCA3, abcA3, LOC100380656, LOC100484901, Abca3, abca3b, LOC101115674
Vector type:
Cloning Vector
Vector backbone:
pCR-XL-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3996086
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens ATP-binding cassette, sub-family A (ABC1), member 3 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ATP Binding Cassette Transporter A3 (ABCA3)
Gene ID:
21 (Human, ABCA3)
Synonyms:
ABCA3, abcA3, LOC100380656, LOC100484901, Abca3, abca3b, LOC101115674
Vector type:
Cloning Vector
Vector backbone:
pFLC1
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4071168
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

Type:
ORF
Application:
Cloning
Gene:
ATP Binding Cassette Transporter A3 (ABCA3)
Gene ID:
21 (Human, ABCA3)
Synonyms:
ABCA3, abcA3, LOC100380656, LOC100484901, Abca3, abca3b, LOC101115674
Insert length:
630 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5321468
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens ATP-binding cassette, sub-family A (ABC1), member 3 with N terminal Myc tag.

Type:
ORF
Application:
Protein Expression
Gene:
ATP Binding Cassette Transporter A3 (ABCA3)
Species:
Human
Synonyms:
ABCA3, abcA3, LOC100380656, LOC100484901, Abca3, abca3b, LOC101115674
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948172

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3610388
$245.00
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens ATP-binding cassette, sub-family A (ABC1), member 3 with N terminal HA tag.

Type:
ORF
Application:
Protein Expression
Gene:
ATP Binding Cassette Transporter A3 (ABCA3)
Species:
Human
Synonyms:
ABCA3, abcA3, LOC100380656, LOC100484901, Abca3, abca3b, LOC101115674
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948171

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3610386
$245.00
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens ATP-binding cassette, sub-family A (ABC1), member 3.

Type:
ORF
Application:
Protein Expression
Gene:
ATP Binding Cassette Transporter A3 (ABCA3)
Species:
Human
Synonyms:
ABCA3, abcA3, LOC100380656, LOC100484901, Abca3, abca3b, LOC101115674
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-untagged
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948161

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3610389
$245.00
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens ATP-binding cassette, sub-family A (ABC1), member 3 with C terminal HA tag.

Type:
ORF
Application:
Protein Expression
Gene:
ATP Binding Cassette Transporter A3 (ABCA3)
Species:
Human
Synonyms:
ABCA3, abcA3, LOC100380656, LOC100484901, Abca3, abca3b, LOC101115674
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3610381
$245.00
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens ATP-binding cassette, sub-family A (ABC1), member 3 with C terminal Myc tag.

Type:
ORF
Application:
Protein Expression
Gene:
ATP Binding Cassette Transporter A3 (ABCA3)
Species:
Human
Synonyms:
ABCA3, abcA3, LOC100380656, LOC100484901, Abca3, abca3b, LOC101115674
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3610383
$245.00
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens ATP-binding cassette, sub-family A (ABC1), member 3 with C terminal His tag.

Type:
ORF
Application:
Protein Expression
Gene:
ATP Binding Cassette Transporter A3 (ABCA3)
Species:
Human
Synonyms:
ABCA3, abcA3, LOC100380656, LOC100484901, Abca3, abca3b, LOC101115674
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3610382
$245.00
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens ATP-binding cassette, sub-family A (ABC1), member 3 with N terminal His tag.

Type:
ORF
Application:
Protein Expression
Gene:
ATP Binding Cassette Transporter A3 (ABCA3)
Species:
Human
Synonyms:
ABCA3, abcA3, LOC100380656, LOC100484901, Abca3, abca3b, LOC101115674
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948173

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3610387
$245.00
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens ATP-binding cassette, sub-family A (ABC1), member 3 with C terminal Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
ATP Binding Cassette Transporter A3 (ABCA3)
Species:
Human
Synonyms:
ABCA3, abcA3, LOC100380656, LOC100484901, Abca3, abca3b, LOC101115674
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3610379
$245.00
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to ABCA3

  • ATP binding cassette subfamily A member 3 (ABCA3)
  • ABC transporter A family protein (abcA3)
  • ATP-binding cassette sub-family A member 3 (LOC100380656)
  • ATP-binding cassette sub-family A member 3 (LOC100484901)
  • ATP-binding cassette, sub-family A (ABC1), member 3 (Abca3)
  • ATP binding cassette subfamily A member 3 (Abca3)
  • ATP-binding cassette, sub-family A (ABC1), member 3b (abca3b)
  • ATP-binding cassette sub-family A member 3 (LOC101115674)
  • 1810036E22Rik
  • ABC-C
  • ABC3
  • Abc3
  • abca3
  • DDBDRAFT_0201662
  • DDBDRAFT_0219856
  • DDB_0201662
  • DDB_0219856
  • EST111653
  • LBM180
  • si:ch211-155i15.6
  • SMDP3

Gene-IDs for different species

GENE IDSPECIES
453833 Pan troglodytes
479879 Canis lupus familiaris
696496 Macaca mulatta
8629224 Dictyostelium discoideum AX4
100345135 Oryctolagus cuniculus
100380656 Salmo salar
100484901 Ailuropoda melanoleuca
21 Homo sapiens
27410 Mus musculus
302973 Rattus norvegicus
416386 Gallus gallus
505787 Bos taurus
564344 Danio rerio
100402635 Callithrix jacchus
100518064 Sus scrofa
101115674 Ovis aries musimon

Protein level used designations for ABCA3

  • ATP-binding cassette, sub-family A member 3
  • ATP-binding cassette, sub-family A (ABC1), member 3
  • ATP-binding cassette sub-family A member 3
  • ATP-binding cassette sub-family A member 3-like
  • ABC transporter 3
  • ABC-C transporter
  • ATP-binding cassette transporter 3
Other products related to ABCA3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com