ABCA6 (ATP-Binding Cassette, Sub-Family A (ABC1), Member 6, ABCA6)

Short Description: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24 and may play a role in macrophage lipid homeostasis. [provided by RefSeq, Jul 2008].
More information related to gene ABCA6.
Products related to ABCA6 Gene:
94 Products
Type
  • 90
  • 4
Species
  • 60
  • 34
Oligo-Type
  • 4
Insert
  • 40
  • 24
  • 14
  • 6
  • 4
Vector
  • 32
  • 27
  • 16
  • 8
  • 6
Vector Backbone
  • 8
  • 8
  • 5
  • 4
  • 4
Fusion tag
  • 27
  • 15
  • 12
  • 11
  • 6
Resistance Gene
  • 45
  • 20
  • 20
  • 5
  • 2
Selectable Marker
  • 28
  • 18
  • 4
Promoter
  • 37
  • 22
  • 16
  • 6
  • 6
Expression Type
  • 85
  • 42
Application
  • 48
  • 24
  • 18
  • 12
Format
  • 36
  • 31
  • 19
  • 8
Supplier: Log in to see

Full length Mus musculus ATP-binding cassette, sub-family A (ABC1), member 6 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family A (ABC1), Member 6 (ABCA6)
Gene ID:
76184 (Mouse (Murine), ABCA6)
Synonyms:
Abca6, ABCA6, LOC100545599
Vector type:
Cloning Vector
Vector backbone:
pCR-XL-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3997465
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus ATP-binding cassette, sub-family A (ABC1), member 6 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family A (ABC1), Member 6 (ABCA6)
Gene ID:
76184 (Mouse (Murine), ABCA6)
Synonyms:
Abca6, ABCA6, LOC100545599
Vector type:
Cloning Vector
Vector backbone:
pCR-XL-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3997466
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus ATP-binding cassette, sub-family A (ABC1), member 6 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family A (ABC1), Member 6 (ABCA6)
Gene ID:
76184 (Mouse (Murine), ABCA6)
Synonyms:
Abca6, ABCA6, LOC100545599
Vector type:
Cloning Vector
Vector backbone:
pCR-XL-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3997468
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus ATP-binding cassette, sub-family A (ABC1), member 6 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family A (ABC1), Member 6 (ABCA6)
Gene ID:
76184 (Mouse (Murine), ABCA6)
Synonyms:
Abca6, ABCA6, LOC100545599
Vector type:
Cloning Vector
Vector backbone:
pCR-XL-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3997467
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

The ATP-binding cassette, sub-family A (ABC1), member 6 ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family A (ABC1), Member 6 (ABCA6)
Gene ID:
23460 (Human, ABCA6)
Synonyms:
Abca6, ABCA6, LOC100545599
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3417311
€265.49
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family A (ABC1), Member 6 (ABCA6)
NCBI Accession:
NM_080284
Species:
Human
Synonyms:
Abca6, ABCA6, LOC100545599
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5737613
€309.73
1 μg
Plus shipping costs €45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family A (ABC1), Member 6
Species:
Mouse (Murine)
Synonyms:
ABCA6, EST155051, 6330565N06Rik
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Abca6 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3349930
€345.13
1 kit
Plus shipping costs €45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family A (ABC1), Member 6
Species:
Human
Synonyms:
ABCA6, EST155051, 6330565N06Rik
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • ABCA6 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3284327
€345.13
1 kit
Plus shipping costs €45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Abca6 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family A (ABC1), Member 6 (ABCA6)
NCBI Accession:
NM_001166557,NP_001160029
Species:
Mouse (Murine)
Synonyms:
Abca6, ABCA6, LOC100545599
Insert length:
978 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308294
€345.13
10 μg
Plus shipping costs €45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Abca6 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family A (ABC1), Member 6 (ABCA6)
NCBI Accession:
NM_001166556,NP_001160028
Species:
Mouse (Murine)
Synonyms:
Abca6, ABCA6, LOC100545599
Insert length:
1167 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308293
€345.13
10 μg
Plus shipping costs €45.00
Delivery in 8 to 11 Business Days
Supplier: Log in to see

Individual gRNA against ABCA6 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family A (ABC1), Member 6 (ABCA6)
NCBI Accession:
NM_080284
Species:
Human
Synonyms:
Abca6, ABCA6, LOC100545599
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABCA6
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113254
€349.56
300 μL
Plus shipping costs €45.00 and €20.00 dry ice
Available
Supplier: Log in to see

Individual gRNA against Abca6 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family A (ABC1), Member 6 (ABCA6)
NCBI Accession:
NM_147218
Species:
Mouse (Murine)
Synonyms:
Abca6, ABCA6, LOC100545599
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abca6
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113256
€349.56
300 μL
Plus shipping costs €45.00 and €20.00 dry ice
Available
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family A (ABC1), Member 6 (ABCA6)
NCBI Accession:
NM_001166556
Species:
Mouse (Murine)
Synonyms:
Abca6, ABCA6, LOC100545599
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5737614
€398.23
1 μg
Plus shipping costs €45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family A (ABC1), Member 6 (ABCA6)
NCBI Accession:
NM_001166557
Species:
Mouse (Murine)
Synonyms:
Abca6, ABCA6, LOC100545599
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5737615
€398.23
1 μg
Plus shipping costs €45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

siRNA to inhibit ABCA6 expression using RNA interference.

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family A (ABC1), Member 6
Gene ID:
76184 (Mouse (Murine), ABCA6)
Synonyms:
ABCA6, EST155051, 6330565N06Rik
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5789184
€404.49
15 nmol
Plus shipping costs €45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

siRNA to inhibit ABCA6 expression using RNA interference.

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family A (ABC1), Member 6
Gene ID:
23460 (Human, ABCA6)
Synonyms:
ABCA6, EST155051, 6330565N06Rik
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5789185
€404.49
15 nmol
Plus shipping costs €45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

Mammalian expression of Human ABCA6 with DYKDDDDK Tag,His tag

Type:
cDNA
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family A (ABC1), Member 6 (ABCA6)
Species:
Human
Synonyms:
Abca6, ABCA6, LOC100545599
Insert length:
558 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4559190
€438.05
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Human ABCA6 with HA tag

Type:
cDNA
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family A (ABC1), Member 6 (ABCA6)
NCBI Accession:
NM_080284
Species:
Human
Synonyms:
Abca6, ABCA6, LOC100545599
Insert length:
558 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4486700
€438.05
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ABCA6 with His tag

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family A (ABC1), Member 6 (ABCA6)
NCBI Accession:
NM_080284
Species:
Human
Synonyms:
Abca6, ABCA6, LOC100545599
Insert length:
558 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4630171
€438.05
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ABCA6 with His-MBP

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family A (ABC1), Member 6 (ABCA6)
NCBI Accession:
NM_080284
Species:
Human
Synonyms:
Abca6, ABCA6, LOC100545599
Insert length:
558 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4696776
€438.05
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ABCA6

  • ATP binding cassette subfamily A member 6 (Abca6)
  • ATP binding cassette subfamily A member 6 (ABCA6)
  • ATP-binding cassette sub-family A member 9 (LOC100545599)
  • ATP-binding cassette, sub-family A (ABC1), member 6 (Abca6)
  • 6330565N06Rik
  • ABCA6
  • EST155051

Gene-IDs for different species

GENE IDSPECIES
303639 Rattus norvegicus
480456 Canis lupus familiaris
537351 Bos taurus
693529 Macaca mulatta
742817 Pan troglodytes
100062487 Equus caballus
100396403 Callithrix jacchus
100449355 Pongo abelii
100473048 Ailuropoda melanoleuca
100520861 Sus scrofa
100545599 Meleagris gallopavo
23460 Homo sapiens
76184 Mus musculus

Protein level used designations for ABCA6

  • ATP-binding cassette sub-family A member 6
  • ATP-binding cassette, sub-family A (ABC1), member 6
  • ATP-binding cassette, sub-family A, member 6
  • ATP-binding cassette sub-family A member 6-like
  • ABC transporter ABCA6
  • ATP-binding cassette A6
  • ATP-binding cassette transporter sub-family A member 6
Other products related to ABCA6 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com