ABCB5 (ATP-Binding Cassette, Sub-Family B (MDR/TAP), Member 5, ABCB5)

Short Description: ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008].
More information related to gene ABCB5.
Products related to ABCB5 Gene:
101 Products
Type
  • 97
  • 4
Species
  • 73
  • 26
  • 2
Oligo-Type
  • 3
  • 1
Insert
  • 43
  • 29
  • 13
  • 6
  • 4
Vector
  • 42
  • 31
  • 8
  • 6
  • 6
Vector Backbone
  • 8
  • 7
  • 7
  • 4
  • 4
Fusion tag
  • 33
  • 16
  • 13
  • 8
  • 6
Resistance Gene
  • 37
  • 37
  • 18
  • 5
  • 2
Selectable Marker
  • 29
  • 18
  • 11
  • 1
Promoter
  • 35
  • 22
  • 21
  • 10
  • 6
Expression Type
  • 78
  • 40
  • 11
Application
  • 64
  • 18
  • 16
  • 12
  • 1
Format
  • 56
  • 18
  • 15
  • 12
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family B (MDR/TAP), Member 5 (ABCB5)
Species:
Human
Synonyms:
ABCB5, Abcb5, abcb5, TGME49_249820, PAAG_04387, VDBG_00160, VDBG_02292
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5737629
€39.82
1 μg
Plus shipping costs €45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 5.

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family B (MDR/TAP), Member 5 (ABCB5)
Species:
Human
Synonyms:
ABCB5, Abcb5, abcb5, TGME49_249820, PAAG_04387, VDBG_00160, VDBG_02292
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545842
€66.37
1 vial
Plus shipping costs €45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Verified forward and reverse primers for analyzing the quantitative expression of gene

Application:
Quantitative real-time PCR
Gene:
ATP-Binding Cassette, Sub-Family B (MDR/TAP), Member 5
Species:
Human
Synonyms:
ABCB5alpha, ABCB5beta, EST422562, 9230106F14Rik, RGD1566342, ABCB5, mdr1, im:7158730, wu:fc18f02, wu:fi81f06
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3192631
€69.91
1 vial
Plus shipping costs €45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Full length Xenopus tropicalis ATP-binding cassette, sub-family B (MDR/TAP), member 5 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family B (MDR/TAP), Member 5 (ABCB5)
Gene ID:
394865 (Xenopus tropicalis, ABCB5)
Synonyms:
ABCB5, Abcb5, abcb5, TGME49_249820, PAAG_04387, VDBG_00160, VDBG_02292
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3882053
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 5 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family B (MDR/TAP), Member 5 (ABCB5)
Gene ID:
340273 (Human, ABCB5)
Synonyms:
ABCB5, Abcb5, abcb5, TGME49_249820, PAAG_04387, VDBG_00160, VDBG_02292
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4017252
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 5 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family B (MDR/TAP), Member 5 (ABCB5)
Gene ID:
340273 (Human, ABCB5)
Synonyms:
ABCB5, Abcb5, abcb5, TGME49_249820, PAAG_04387, VDBG_00160, VDBG_02292
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4017251
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus tropicalis ATP-binding cassette, sub-family B (MDR/TAP), member 5 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family B (MDR/TAP), Member 5 (ABCB5)
Gene ID:
394865 (Xenopus tropicalis, ABCB5)
Synonyms:
ABCB5, Abcb5, abcb5, TGME49_249820, PAAG_04387, VDBG_00160, VDBG_02292
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3882054
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 5 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family B (MDR/TAP), Member 5 (ABCB5)
Gene ID:
340273 (Human, ABCB5)
Synonyms:
ABCB5, Abcb5, abcb5, TGME49_249820, PAAG_04387, VDBG_00160, VDBG_02292
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4017253
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 5 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family B (MDR/TAP), Member 5 (ABCB5)
Gene ID:
340273 (Human, ABCB5)
Synonyms:
ABCB5, Abcb5, abcb5, TGME49_249820, PAAG_04387, VDBG_00160, VDBG_02292
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4017254
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

Type:
ORF
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family B (MDR/TAP), Member 5 (ABCB5)
Gene ID:
340273 (Human, ABCB5)
Synonyms:
ABCB5, Abcb5, abcb5, TGME49_249820, PAAG_04387, VDBG_00160, VDBG_02292
Insert length:
2439 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5324422
€189.97
2 μg
Plus shipping costs €45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

The ATP-binding cassette, sub-family B (MDR/TAP), member 5 ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family B (MDR/TAP), Member 5 (ABCB5)
Gene ID:
340273 (Human, ABCB5)
Synonyms:
ABCB5, Abcb5, abcb5, TGME49_249820, PAAG_04387, VDBG_00160, VDBG_02292
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3414139
€265.49
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

The ATP-binding cassette, sub-family B (MDR/TAP), member 5 ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family B (MDR/TAP), Member 5 (ABCB5)
Gene ID:
340273 (Human, ABCB5)
Synonyms:
ABCB5, Abcb5, abcb5, TGME49_249820, PAAG_04387, VDBG_00160, VDBG_02292
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3428219
€265.49
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family B (MDR/TAP), Member 5
Species:
Human
Synonyms:
ABCB5alpha, ABCB5beta, EST422562, 9230106F14Rik, RGD1566342, ABCB5, mdr1, im:7158730, wu:fc18f02, wu:fi81f06
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • ABCB5 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3314490
€265.49
1 kit
Plus shipping costs €45.00
Delivery in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ABCB5 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family B (MDR/TAP), Member 5 (ABCB5)
NCBI Accession:
NM_001163993,NP_001157465
Species:
Human
Synonyms:
ABCB5, Abcb5, abcb5, TGME49_249820, PAAG_04387, VDBG_00160, VDBG_02292
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3320539
€345.13
10 μg
Plus shipping costs €45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ABCB5 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family B (MDR/TAP), Member 5 (ABCB5)
NCBI Accession:
NM_001163942,NP_001157414
Species:
Human
Synonyms:
ABCB5, Abcb5, abcb5, TGME49_249820, PAAG_04387, VDBG_00160, VDBG_02292
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3320540
€345.13
10 μg
Plus shipping costs €45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family B (MDR/TAP), Member 5
Species:
Mouse (Murine)
Synonyms:
ABCB5alpha, ABCB5beta, EST422562, 9230106F14Rik, RGD1566342, ABCB5, mdr1, im:7158730, wu:fc18f02, wu:fi81f06
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Abcb5 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3349382
€345.13
1 kit
Plus shipping costs €45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Individual gRNA against ABCB5 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family B (MDR/TAP), Member 5 (ABCB5)
NCBI Accession:
NM_178559
Species:
Human
Synonyms:
ABCB5, Abcb5, abcb5, TGME49_249820, PAAG_04387, VDBG_00160, VDBG_02292
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABCB5
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113284
€349.56
300 μL
Plus shipping costs €45.00 and €20.00 dry ice
Available
Supplier: Log in to see

Individual gRNA against Abcb5 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family B (MDR/TAP), Member 5 (ABCB5)
NCBI Accession:
NM_029961
Species:
Mouse (Murine)
Synonyms:
ABCB5, Abcb5, abcb5, TGME49_249820, PAAG_04387, VDBG_00160, VDBG_02292
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abcb5
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113286
€349.56
300 μL
Plus shipping costs €45.00 and €20.00 dry ice
Available
Supplier: Log in to see

Mammalian Vector with ORF clone of Human ATP-binding cassette, sub-family B (MDR/TAP), member 5 (ABCB5) transcript variant 3

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family B (MDR/TAP), Member 5 (ABCB5)
NCBI Accession:
NM_001163942,NP_001157414
Species:
Human
Synonyms:
ABCB5, Abcb5, abcb5, TGME49_249820, PAAG_04387, VDBG_00160, VDBG_02292
Insert length:
396 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5391359
€355.75
10 μg
Plus shipping costs €45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human ATP-binding cassette, sub-family B (MDR/TAP), member 5 (ABCB5) transcript variant 4

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family B (MDR/TAP), Member 5 (ABCB5)
NCBI Accession:
NM_001163993,NP_001157465
Species:
Human
Synonyms:
ABCB5, Abcb5, abcb5, TGME49_249820, PAAG_04387, VDBG_00160, VDBG_02292
Insert length:
381 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5391358
€355.75
10 μg
Plus shipping costs €45.00
Delivery in 8 to 10 Business Days
  • <
  • 1

Synonyms and alternative names related to ABCB5

  • ATP binding cassette subfamily B member 5 (ABCB5)
  • ATP-binding cassette, sub-family B (MDR/TAP), member 5 (Abcb5)
  • ATP binding cassette subfamily B member 5 (Abcb5)
  • ATP-binding cassette, sub-family B (MDR/TAP), member 5 (abcb5)
  • ATP-binding cassette sub-family B member 5 (TGME49_249820)
  • ATP-binding cassette sub-family B member 5 (PAAG_04387)
  • ATP-binding cassette sub-family B member 5 (VDBG_00160)
  • ATP-binding cassette sub-family B member 5 (VDBG_02292)
  • 9230106F14Rik
  • ABCB5
  • ABCB5alpha
  • ABCB5beta
  • EST422562
  • im:7158730
  • mdr1
  • RGD1566342
  • wu:fc18f02
  • wu:fi81f06

Gene-IDs for different species

GENE IDSPECIES
340273 Homo sapiens
77706 Mus musculus
314537 Rattus norvegicus
482344 Canis lupus familiaris
536724 Bos taurus
743269 Pan troglodytes
798527 Danio rerio
7895945 Toxoplasma gondii ME49
9096905 Paracoccidioides sp. 'lutzii' Pb01
9528586 Verticillium alfalfae VaMs.102
9532576 Verticillium alfalfae VaMs.102
100067103 Equus caballus
100346799 Oryctolagus cuniculus
100734814 Cavia porcellus

Protein level used designations for ABCB5

  • ABCB5 P-gp
  • ATP-binding cassette protein
  • ATP-binding cassette sub-family B member 5
  • P-glycoprotein ABCB5
  • ATP-binding cassette, sub-family B (MDR/TAP), member 5
  • ATP-binding cassette, sub-family B, member 5
  • ABC efflux transporter 5
  • abcb1a
  • LOW QUALITY PROTEIN: ATP-binding cassette sub-family B member 5
Other products related to ABCB5 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com