ABCC1 (ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1, ABCC1)

Short Description: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra-and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions as a multispecific organic anion transporter, with oxidized glutatione, cysteinyl leukotrienes, and activated aflatoxin B1 as substrates. This protein also transports glucuronides and sulfate conjugates of steroid hormones and bile salts. Alternatively spliced variants of this gene have been described but their full-length nature is unknown. [provided by RefSeq, Apr 2012].
More information related to gene ABCC1.
Products related to ABCC1 Gene:
77 Products
Data Quality
  • 1
Type
  • 71
  • 6
Species
  • 27
  • 26
  • 22
  • 2
Application
  • 38
  • 25
  • 16
  • 12
Fusion tag
  • 31
  • 13
  • 7
  • 6
  • 6
Vector Backbone
  • 6
  • 6
  • 4
  • 4
  • 3
Vector
  • 27
  • 24
  • 9
  • 8
  • 2
Insert
  • 23
  • 19
  • 13
  • 8
  • 6
Oligo-Type
  • 6
Resistance Gene
  • 30
  • 26
  • 12
  • 3
  • 2
Expression Type
  • 70
  • 43
  • 2
Selectable Marker
  • 24
  • 21
Promoter
  • 31
  • 21
  • 9
  • 8
  • 8
Format
  • 34
  • 19
  • 18
  • 6
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
Gene ID:
100145582 (Xenopus tropicalis, ABCC1)
Synonyms:
ABCC1, Abcc1, LOC100152428, LOC100346553
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4032590
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
Gene ID:
100145582 (Xenopus tropicalis, ABCC1)
Synonyms:
ABCC1, Abcc1, LOC100152428, LOC100346553
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4032591
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
Gene ID:
4363 (Human, ABCC1)
Synonyms:
ABCC1, Abcc1, LOC100152428, LOC100346553
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3416785
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1
Species:
Rat (Rattus)
Synonyms:
ABC29, ABCC, GS-X, MRP, MRP1, Abcc1a, Abcc1b, Mdrap, Mrp1, Avcc1a, Mrp, ABCC13
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Abcc1 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3351021
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1
Species:
Mouse (Murine)
Synonyms:
ABC29, ABCC, GS-X, MRP, MRP1, Abcc1a, Abcc1b, Mdrap, Mrp1, Avcc1a, Mrp, ABCC13
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Abcc1 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3349818
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
NCBI Accession:
NM_019899
Species:
Human
Synonyms:
ABCC1, Abcc1, LOC100152428, LOC100346553
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABCC1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113306
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
NCBI Accession:
NM_008576
Species:
Mouse (Murine)
Synonyms:
ABCC1, Abcc1, LOC100152428, LOC100346553
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abcc1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113308
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
NCBI Accession:
NM_022281
Species:
Rat (Rattus)
Synonyms:
ABCC1, Abcc1, LOC100152428, LOC100346553
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abcc1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113310
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1
Species:
Human
Synonyms:
ABC29, ABCC, GS-X, MRP, MRP1, Abcc1a, Abcc1b, Mdrap, Mrp1, Avcc1a, Mrp, ABCC13
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • ABCC1 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Publications
  • Hong, Liu, Zhao, Tan, Wu, Li, Liang, Qiu, Lu: "Cycloartenyl Ferulate Inhibits Paraquat-Induced Apoptosis in HK-2 Cells With the Involvement of ABCC1." in: Journal of cellular biochemistry, Vol. 117, Issue 4, pp. 872-80, 2016 (Pubmed)
Catalog No. ABIN3342743
$420.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
Supplier: Log in to see

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
Gene ID:
4363 (Human, ABCC1)
Synonyms:
ABCC1, Abcc1, LOC100152428, LOC100346553
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5056247

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5037302
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1
Gene ID:
4363 (Human, ABCC1)
Synonyms:
ABC29, ABCC, GS-X, MRP, MRP1, Abcc1a, Abcc1b, Mdrap, Mrp1, Avcc1a, Mrp, ABCC13
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5789208
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1
Gene ID:
24565 (Rat (Rattus), ABCC1)
Synonyms:
ABC29, ABCC, GS-X, MRP, MRP1, Abcc1a, Abcc1b, Mdrap, Mrp1, Avcc1a, Mrp, ABCC13
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5789209
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1
Gene ID:
17250 (Mouse (Murine), ABCC1)
Synonyms:
ABC29, ABCC, GS-X, MRP, MRP1, Abcc1a, Abcc1b, Mdrap, Mrp1, Avcc1a, Mrp, ABCC13
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5789210
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
NCBI Accession:
NM_019899
Species:
Human
Synonyms:
ABCC1, Abcc1, LOC100152428, LOC100346553
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABCC1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5228640
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
NCBI Accession:
NM_008576
Species:
Mouse (Murine)
Synonyms:
ABCC1, Abcc1, LOC100152428, LOC100346553
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abcc1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5228642
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
NCBI Accession:
NM_022281
Species:
Rat (Rattus)
Synonyms:
ABCC1, Abcc1, LOC100152428, LOC100346553
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abcc1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5228644
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
NCBI Accession:
NM_019902,NP_063957
Species:
Human
Synonyms:
ABCC1, Abcc1, LOC100152428, LOC100346553
Insert length:
6000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, SP6 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948185

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3393334
$640.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
Supplier: Log in to see

Type:
shRNA
Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
Gene ID:
4363 (Human, ABCC1)
Synonyms:
ABCC1, Abcc1, LOC100152428, LOC100346553
Vector type:
Lentiviral Vector
Vector backbone:
pZIP-mCMV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
mCMV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Empty vector controls:
ABIN5691888
Viral particles:
ABIN3482824

Components:
3 separate shRNA clones and a non-targeting control
Format:
Glycerol Stock
Buffer:
E. coli bacterial culture in LB-Lennox (low salt) broth with 8 % glycerol.
Storage:
-80 °C
Catalog No. ABIN3482823
$703.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
shRNA
Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
Gene ID:
17250 (Mouse (Murine), ABCC1)
Synonyms:
ABCC1, Abcc1, LOC100152428, LOC100346553
Vector type:
Lentiviral Vector
Vector backbone:
pZIP-mCMV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
mCMV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Empty vector controls:
ABIN5691888
Viral particles:
ABIN3482824

Components:
3 separate shRNA clones and a non-targeting control
Format:
Glycerol Stock
Buffer:
E. coli bacterial culture in LB-Lennox (low salt) broth with 8 % glycerol.
Storage:
-80 °C
Catalog No. ABIN3783594
$703.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
shRNA
Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
Species:
Human
Synonyms:
ABCC1, Abcc1, LOC100152428, LOC100346553
Vector type:
Retroviral Vector
Vector backbone:
pRFP-C-RS
Resistance Gene:
Chloramphenicol
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Fusion Tag:
RFP tag
Expression:
Transient, Stable

Empty vector controls:
ABIN4948188

Components:
  • Gene-specific shRNA expression pRFP-C-RS vectors, 5 ug plasmid DNA per vial.
  • Four unique constructs per gene.
  • HuSH 29-mer NonEffective Scrambled pGFP-VRS 5 ug plasmid DNA.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN3711467
$715.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to ABCC1

  • ATP binding cassette subfamily C member 1 (ABCC1)
  • ATP-binding cassette, sub-family C (CFTR/MRP), member 1 (Abcc1)
  • ATP binding cassette subfamily C member 1 (Abcc1)
  • multidrug resistance-associated protein 1 (LOC100152428)
  • multidrug resistance-associated protein 1 (LOC100346553)
  • ABC29
  • ABCC
  • Abcc1a
  • Abcc1b
  • ABCC13
  • Avcc1a
  • GS-X
  • Mdrap
  • MRP
  • Mrp
  • MRP1
  • Mrp1

Gene-IDs for different species

GENE IDSPECIES
4363 Homo sapiens
281588 Bos taurus
395416 Gallus gallus
403453 Canis lupus familiaris
17250 Mus musculus
24565 Rattus norvegicus
100734674 Cavia porcellus
733619 Sus scrofa
791240 Equus caballus
100345841 Oryctolagus cuniculus
100152428 Sus scrofa
100346553 Oryctolagus cuniculus

Protein level used designations for ABCC1

  • ATP-binding cassette transporter variant ABCC1delta-ex13
  • ATP-binding cassette transporter variant ABCC1delta-ex13&14
  • ATP-binding cassette transporter variant ABCC1delta-ex25
  • ATP-binding cassette transporter variant ABCC1delta-ex25&26
  • LTC4 transporter
  • leukotriene C(4) transporter
  • multidrug resistance-associated protein 1
  • ATP-binding cassette sub-family C member 1
  • multidrug resistance protein 1
  • ATP-binding cassette, sub-family C (CFTR/MRP), member 1a
  • ATP-binding cassette, sub-family C (CFTR/MRP), member 1b
  • multiple drug resistance-associated protein
  • ATP-binding cassette sub-family C ( CFTR/MRP) member 1a
  • ATP-binding cassette, sub-family C (CFTR/MRP), member 1
  • ATP-binding cassette superfamily member C1
  • ATP-binding cassette transporter sub-family C member 1
  • ATP-binding cassette, sub-family C, member 1
  • multiple drug resistance protein 1
  • ATP-binding cassette, sub-family C (CFTR/MRP), member 13
Other products related to ABCC1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com