ABCC1 (ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1, ABCC1)

Short Description: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra-and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions as a multispecific organic anion transporter, with oxidized glutatione, cysteinyl leukotrienes, and activated aflatoxin B1 as substrates. This protein also transports glucuronides and sulfate conjugates of steroid hormones and bile salts. Alternatively spliced variants of this gene have been described but their full-length nature is unknown. [provided by RefSeq, Apr 2012].
More information related to gene ABCC1.
Products related to ABCC1 Gene:
77 Products
Data Quality
  • 1
  • 71
  • 6
  • 27
  • 26
  • 22
  • 2
  • 38
  • 25
  • 16
  • 12
Fusion tag
  • 31
  • 13
  • 7
  • 6
  • 6
Vector Backbone
  • 6
  • 6
  • 4
  • 4
  • 3
  • 27
  • 24
  • 9
  • 8
  • 2
  • 23
  • 19
  • 13
  • 8
  • 6
  • 6
Resistance Gene
  • 30
  • 26
  • 12
  • 3
  • 2
Expression Type
  • 70
  • 43
  • 2
Selectable Marker
  • 24
  • 21
  • 31
  • 21
  • 9
  • 8
  • 8
  • 34
  • 19
  • 18
  • 6
Supplier: Log in to see

Full length Xenopus tropicalis ATP-binding cassette, sub-family C (CFTR/MRP), member 1 cDNA clone.

Protein Expression, Cloning
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
Gene ID:
100145582 (Xenopus tropicalis, ABCC1)
ABCC1, Abcc1, LOC100152428, LOC100346553
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4032590
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus tropicalis ATP-binding cassette, sub-family C (CFTR/MRP), member 1 cDNA clone.

Protein Expression, Cloning
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
Gene ID:
100145582 (Xenopus tropicalis, ABCC1)
ABCC1, Abcc1, LOC100152428, LOC100346553
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4032591
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

The ATP-binding cassette, sub-family C (CFTR/MRP), member 1 ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Protein Expression
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
Gene ID:
4363 (Human, ABCC1)
ABCC1, Abcc1, LOC100152428, LOC100346553
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3416785
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Individual gRNA against ABCC1 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Genome Editing with Engineered Nucleases, Protein Expression
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
NCBI Accession:
ABCC1, Abcc1, LOC100152428, LOC100346553
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABCC1
Viral Particles
-80 °C
Catalog No. ABIN5113306
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

Individual gRNA against Abcc1 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Genome Editing with Engineered Nucleases, Protein Expression
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
NCBI Accession:
Rat (Rattus)
ABCC1, Abcc1, LOC100152428, LOC100346553
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abcc1
Viral Particles
-80 °C
Catalog No. ABIN5113310
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

Individual gRNA against Abcc1 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Genome Editing with Engineered Nucleases, Protein Expression
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
NCBI Accession:
Mouse (Murine)
ABCC1, Abcc1, LOC100152428, LOC100346553
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abcc1
Viral Particles
-80 °C
Catalog No. ABIN5113308
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

RNA Interference
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1
Mouse (Murine)
ABC29, ABCC, GS-X, MRP, MRP1, Abcc1a, Abcc1b, Mdrap, Mrp1, Avcc1a, Mrp, ABCC13
HPLC purified
Available with shipment
  • Abcc1 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3349818
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

RNA Interference
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1
ABC29, ABCC, GS-X, MRP, MRP1, Abcc1a, Abcc1b, Mdrap, Mrp1, Avcc1a, Mrp, ABCC13
HPLC purified
Available with shipment
  • ABCC1 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
  • Hong, Liu, Zhao, Tan, Wu, Li, Liang, Qiu, Lu: "Cycloartenyl Ferulate Inhibits Paraquat-Induced Apoptosis in HK-2 Cells With the Involvement of ABCC1." in: Journal of cellular biochemistry, Vol. 117, Issue 4, pp. 872-80, 2016 (Pubmed)
Catalog No. ABIN3342743
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

RNA Interference
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1
Rat (Rattus)
ABC29, ABCC, GS-X, MRP, MRP1, Abcc1a, Abcc1b, Mdrap, Mrp1, Avcc1a, Mrp, ABCC13
HPLC purified
Available with shipment
  • Abcc1 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3351021
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

siRNA to inhibit ABCC1 expression using RNA interference.

RNA Interference
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1
Gene ID:
24565 (Rat (Rattus), ABCC1)
ABC29, ABCC, GS-X, MRP, MRP1, Abcc1a, Abcc1b, Mdrap, Mrp1, Avcc1a, Mrp, ABCC13
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
-20 °C
Catalog No. ABIN5789209
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

siRNA to inhibit ABCC1 expression using RNA interference.

RNA Interference
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1
Gene ID:
17250 (Mouse (Murine), ABCC1)
ABC29, ABCC, GS-X, MRP, MRP1, Abcc1a, Abcc1b, Mdrap, Mrp1, Avcc1a, Mrp, ABCC13
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
-20 °C
Catalog No. ABIN5789210
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

siRNA to inhibit ABCC1 expression using RNA interference.

RNA Interference
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1
Gene ID:
4363 (Human, ABCC1)
ABC29, ABCC, GS-X, MRP, MRP1, Abcc1a, Abcc1b, Mdrap, Mrp1, Avcc1a, Mrp, ABCC13
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
-20 °C
Catalog No. ABIN5789208
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - with 3 vectors containing two gRNAs in each vector plus a negative control (glycerol stock)

Genome Editing with Engineered Nucleases
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
Gene ID:
4363 (Human, ABCC1)
ABCC1, Abcc1, LOC100152428, LOC100346553
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
SFFV Promoter, U6 Promoter
Fusion Tag:
Transient, Stable

Viral particles:

- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Glycerol Stock
-80 °C
Catalog No. ABIN5037302
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Individual gRNA against ABCC1 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (sgRNA and Cas9 in a single vector)

gRNA + Cas9
Genome Editing with Engineered Nucleases, Protein Expression
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
NCBI Accession:
ABCC1, Abcc1, LOC100152428, LOC100346553
Vector type:
Lentiviral Vector
Resistance Gene:
Selection Marker:
U6 Promoter, SFFV Promoter
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABCC1
Viral Particles
-80 °C
Catalog No. ABIN5228640
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

Individual gRNA against Abcc1 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (sgRNA and Cas9 in a single vector)

gRNA + Cas9
Genome Editing with Engineered Nucleases, Protein Expression
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
NCBI Accession:
Mouse (Murine)
ABCC1, Abcc1, LOC100152428, LOC100346553
Vector type:
Lentiviral Vector
Resistance Gene:
Selection Marker:
U6 Promoter, SFFV Promoter
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abcc1
Viral Particles
-80 °C
Catalog No. ABIN5228642
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

Individual gRNA against Abcc1 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (sgRNA and Cas9 in a single vector)

gRNA + Cas9
Genome Editing with Engineered Nucleases, Protein Expression
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
NCBI Accession:
Rat (Rattus)
ABCC1, Abcc1, LOC100152428, LOC100346553
Vector type:
Lentiviral Vector
Resistance Gene:
Selection Marker:
U6 Promoter, SFFV Promoter
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abcc1
Viral Particles
-80 °C
Catalog No. ABIN5228644
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

Untagged full-length cDNA clone from Human ABCC1 is ideal for over-expression of native protein for functional studies.

Protein Expression
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
NCBI Accession:
ABCC1, Abcc1, LOC100152428, LOC100346553
Insert length:
6000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, SP6 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3393334
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
Supplier: Log in to see

shERWOOD-UltramiR shRNA Lentiviral Target Gene Set in pZIP-mCMV-ZsGreen (Glycerol Stock) for fast and most complete knockdown.

RNA Interference
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
Gene ID:
17250 (Mouse (Murine), ABCC1)
ABCC1, Abcc1, LOC100152428, LOC100346553
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
mCMV Promoter
Fusion Tag:
Transient, Stable

Empty vector controls:
Viral particles:

3 separate shRNA clones and a non-targeting control
Glycerol Stock
E. coli bacterial culture in LB-Lennox (low salt) broth with 8 % glycerol.
-80 °C
Catalog No. ABIN3783594
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

shERWOOD-UltramiR shRNA Lentiviral Target Gene Set in pZIP-mCMV-ZsGreen (Glycerol Stock) for fast and most complete knockdown.

RNA Interference
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
Gene ID:
4363 (Human, ABCC1)
ABCC1, Abcc1, LOC100152428, LOC100346553
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
mCMV Promoter
Fusion Tag:
Transient, Stable

Empty vector controls:
Viral particles:

3 separate shRNA clones and a non-targeting control
Glycerol Stock
E. coli bacterial culture in LB-Lennox (low salt) broth with 8 % glycerol.
-80 °C
Catalog No. ABIN3482823
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

shRNA Plasmid to inhibit ABCC1 expression by RNA interference.

RNA Interference
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1 (ABCC1)
Gene ID:
4363 (Human, ABCC1)
ABCC1, Abcc1, LOC100152428, LOC100346553
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter, U6 Promoter
Fusion Tag:
GFP tag
Stable, Transient

This product contains 3 separate slightly different shRNA sequences which knock down human ABCC1 gene specifically. Each vial contains 50 μg of lyophilized shRNA.
4 °C,-20 °C,-80 °C
Catalog No. ABIN5819056
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to ABCC1

  • ATP binding cassette subfamily C member 1 (ABCC1)
  • ATP-binding cassette, sub-family C (CFTR/MRP), member 1 (Abcc1)
  • ATP binding cassette subfamily C member 1 (Abcc1)
  • multidrug resistance-associated protein 1 (LOC100152428)
  • multidrug resistance-associated protein 1 (LOC100346553)
  • ABC29
  • ABCC
  • Abcc1a
  • Abcc1b
  • ABCC13
  • Avcc1a
  • GS-X
  • Mdrap
  • MRP
  • Mrp
  • MRP1
  • Mrp1

Gene-IDs for different species

4363 Homo sapiens
281588 Bos taurus
395416 Gallus gallus
403453 Canis lupus familiaris
17250 Mus musculus
24565 Rattus norvegicus
100734674 Cavia porcellus
733619 Sus scrofa
791240 Equus caballus
100345841 Oryctolagus cuniculus
100152428 Sus scrofa
100346553 Oryctolagus cuniculus

Protein level used designations for ABCC1

  • ATP-binding cassette transporter variant ABCC1delta-ex13
  • ATP-binding cassette transporter variant ABCC1delta-ex13&14
  • ATP-binding cassette transporter variant ABCC1delta-ex25
  • ATP-binding cassette transporter variant ABCC1delta-ex25&26
  • LTC4 transporter
  • leukotriene C(4) transporter
  • multidrug resistance-associated protein 1
  • ATP-binding cassette sub-family C member 1
  • multidrug resistance protein 1
  • ATP-binding cassette, sub-family C (CFTR/MRP), member 1a
  • ATP-binding cassette, sub-family C (CFTR/MRP), member 1b
  • multiple drug resistance-associated protein
  • ATP-binding cassette sub-family C ( CFTR/MRP) member 1a
  • ATP-binding cassette, sub-family C (CFTR/MRP), member 1
  • ATP-binding cassette superfamily member C1
  • ATP-binding cassette transporter sub-family C member 1
  • ATP-binding cassette, sub-family C, member 1
  • multiple drug resistance protein 1
  • ATP-binding cassette, sub-family C (CFTR/MRP), member 13
Other products related to ABCC1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website