ABCC6 (ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6, ABCC6)

Short Description: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). The encoded protein, a member of the MRP subfamily, is involved in multi-drug resistance. Mutations in this gene cause pseudoxanthoma elasticum. Alternatively spliced transcript variants that encode different proteins have been described for this gene. [provided by RefSeq, Jul 2008].
More information related to gene ABCC6.
Products related to ABCC6 Gene:
96 Products
Data Quality
  • 1
Type
  • 90
  • 6
Species
  • 44
  • 28
  • 24
Oligo-Type
  • 6
Insert
  • 30
  • 23
  • 21
  • 8
  • 6
Vector
  • 35
  • 28
  • 12
  • 9
  • 5
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Fusion tag
  • 31
  • 17
  • 11
  • 9
  • 8
Resistance Gene
  • 38
  • 30
  • 18
  • 4
  • 2
Selectable Marker
  • 28
  • 26
  • 2
Promoter
  • 34
  • 31
  • 13
  • 8
  • 6
Expression Type
  • 87
  • 51
Application
  • 47
  • 27
  • 18
  • 16
Format
  • 41
  • 27
  • 22
  • 6
Supplier: Log in to see

Mammalian Vector with ORF clone of Human ATP-binding cassette, sub-family C (CFTR/MRP), member 6 (ABCC6) transcript variant 2

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
NCBI Accession:
NM_001079528,NP_001072996
Species:
Human
Synonyms:
ABCC6, Abcc6
Insert length:
300 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5391451
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Full length Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 6 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
Gene ID:
368 (Human, ABCC6)
Synonyms:
ABCC6, Abcc6
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3985100
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 6 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
Gene ID:
368 (Human, ABCC6)
Synonyms:
ABCC6, Abcc6
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3985099
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

Type:
ORF
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
Gene ID:
368 (Human, ABCC6)
Synonyms:
ABCC6, Abcc6
Insert length:
4512 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5325830
$234.80
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
Species:
Human
Synonyms:
ABCC6, Abcc6
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5737658
$300.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6
Species:
Human
Synonyms:
ABC34, ARA, EST349056, GACI2, MLP1, MOAT-E, MOATE, MRP6, PXE, PXE1, URG7, Abcc1b, DCC, Dyscalc1, Mrp6, dyscalc
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • ABCC6 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3340059
$300.00
1 kit
Plus shipping costs $45.00
Delivery in 8 to 11 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6
Species:
Mouse (Murine)
Synonyms:
ABC34, ARA, EST349056, GACI2, MLP1, MOAT-E, MOATE, MRP6, PXE, PXE1, URG7, Abcc1b, DCC, Dyscalc1, Mrp6, dyscalc
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Abcc6 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3349778
$390.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6
Species:
Rat (Rattus)
Synonyms:
ABC34, ARA, EST349056, GACI2, MLP1, MOAT-E, MOATE, MRP6, PXE, PXE1, URG7, Abcc1b, DCC, Dyscalc1, Mrp6, dyscalc
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Abcc6 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3357577
$390.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ABCC6 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
NCBI Accession:
NM_001079528,NP_001072996
Species:
Human
Synonyms:
ABCC6, Abcc6
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3320547
$390.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Individual gRNA against ABCC6 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
NCBI Accession:
NM_001079528
Species:
Human
Synonyms:
ABCC6, Abcc6
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABCC6
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113336
$395.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Individual gRNA against Abcc6 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
NCBI Accession:
NM_018795
Species:
Mouse (Murine)
Synonyms:
ABCC6, Abcc6
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abcc6
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113338
$395.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Individual gRNA against Abcc6 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
NCBI Accession:
NM_031013
Species:
Rat (Rattus)
Synonyms:
ABCC6, Abcc6
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abcc6
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113340
$395.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Bacterial expression of Human ABCC6 with His-MBP

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
Species:
Human
Synonyms:
ABCC6, Abcc6
Insert length:
4512 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4696794
$425.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ABCC6 with His tag

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
Species:
Human
Synonyms:
ABCC6, Abcc6
Insert length:
4512 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4627172
$425.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ABCC6 with His-GST

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
Species:
Human
Synonyms:
ABCC6, Abcc6
Insert length:
4512 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4825923
$425.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ABCC6 with His tag

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
Species:
Human
Synonyms:
ABCC6, Abcc6
Insert length:
4512 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4775393
$425.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Human ABCC6 with HA tag

Type:
cDNA
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
Species:
Human
Synonyms:
ABCC6, Abcc6
Insert length:
4512 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4483701
$425.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Human ABCC6 with His tag

Type:
cDNA
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
Species:
Human
Synonyms:
ABCC6, Abcc6
Insert length:
4512 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4418615
$425.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human ATP-binding cassette, sub-family C (CFTR/MRP), member 6 (ABCC6) transcript variant 2

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
Species:
Human
Synonyms:
ABCC6, Abcc6
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-GFP
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5391449
$443.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

siRNA to inhibit ABCC6 expression using RNA interference.

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6
Gene ID:
368 (Human, ABCC6)
Synonyms:
ABC34, ARA, EST349056, GACI2, MLP1, MOAT-E, MOATE, MRP6, PXE, PXE1, URG7, Abcc1b, DCC, Dyscalc1, Mrp6, dyscalc
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5789220
$465.17
15 nmol
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to ABCC6

  • ATP binding cassette subfamily C member 6 (ABCC6)
  • ATP-binding cassette, sub-family C (CFTR/MRP), member 6 (Abcc6)
  • ATP binding cassette subfamily C member 6 (Abcc6)
  • ABC34
  • Abcc1b
  • ARA
  • DCC
  • dyscalc
  • Dyscalc1
  • EST349056
  • GACI2
  • MLP1
  • MOAT-E
  • MOATE
  • MRP6
  • Mrp6
  • PXE
  • PXE1
  • URG7

Gene-IDs for different species

GENE IDSPECIES
368 Homo sapiens
27421 Mus musculus
81642 Rattus norvegicus

Protein level used designations for ABCC6

  • ATP-binding cassette sub-family C member 6
  • anthracycline resistance-associated protein
  • multi-specific organic anion transporter E
  • multidrug resistance-associated protein 6
  • ATP-binding cassette, sub-family C, member 6
  • multidrug resistance-associated protein-6
  • ATP-binding cassette, sub-family C (CFTR/MRP), member 6
  • MLP-1
  • MRP-like protein 1
  • liver multidrug resistance-associated protein 6
Other products related to ABCC6 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com