ABCC6 (ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6, ABCC6)

Short Description: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). The encoded protein, a member of the MRP subfamily, is involved in multi-drug resistance. Mutations in this gene cause pseudoxanthoma elasticum. Alternatively spliced transcript variants that encode different proteins have been described for this gene. [provided by RefSeq, Jul 2008].
More information related to gene ABCC6.
Products related to ABCC6 Gene:
Data Quality
  • 1
Type
  • 86
  • 3
Species
  • 41
  • 26
  • 22
Application
  • 47
  • 21
  • 17
  • 16
Fusion tag
  • 27
  • 14
  • 11
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 35
  • 25
  • 12
  • 9
  • 4
Insert
  • 29
  • 23
  • 18
  • 8
  • 6
Oligo-Type
  • 3
Resistance Gene
  • 34
  • 30
  • 18
  • 4
  • 2
Expression Type
  • 84
  • 48
Selectable Marker
  • 26
  • 25
  • 1
Promoter
  • 31
  • 28
  • 13
  • 8
  • 6
Format
  • 35
  • 27
  • 22
  • 5
89 Products

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
NCBI Accession:
NM_001079528,NP_001072996
Species:
Human
Synonyms:
ABCC6, Abcc6
Insert length:
300 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5391451
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
Gene ID:
368 (Human, ABCC6)
Synonyms:
ABCC6, Abcc6
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3985099
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
Gene ID:
368 (Human, ABCC6)
Synonyms:
ABCC6, Abcc6
Insert length:
4512 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5325830
$249.35
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
NCBI Accession:
NM_001079528,NP_001072996
Species:
Human
Synonyms:
ABCC6, Abcc6
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3320547
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
NCBI Accession:
NM_001079528
Species:
Human
Synonyms:
ABCC6, Abcc6
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABCC6
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113336
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
NCBI Accession:
NM_031013
Species:
Rat
Synonyms:
ABCC6, Abcc6
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abcc6
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113340
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
NCBI Accession:
NM_018795
Species:
Mouse
Synonyms:
ABCC6, Abcc6
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abcc6
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113338
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6
Species:
Human
Synonyms:
ABC34, ARA, EST349056, GACI2, MLP1, MOAT-E, MOATE, MRP6, PXE, PXE1, URG7, Abcc1b, DCC, Dyscalc1, Mrp6, dyscalc
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • ABCC6 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3340059
$440.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6
Species:
Mouse
Synonyms:
ABC34, ARA, EST349056, GACI2, MLP1, MOAT-E, MOATE, MRP6, PXE, PXE1, URG7, Abcc1b, DCC, Dyscalc1, Mrp6, dyscalc
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Abcc6 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3349778
$440.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6
Species:
Rat
Synonyms:
ABC34, ARA, EST349056, GACI2, MLP1, MOAT-E, MOATE, MRP6, PXE, PXE1, URG7, Abcc1b, DCC, Dyscalc1, Mrp6, dyscalc
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Abcc6 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3357577
$440.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
Species:
Human
Synonyms:
ABCC6, Abcc6
Insert length:
4512 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5737658
$441.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
Species:
Human
Synonyms:
ABCC6, Abcc6
Insert length:
4512 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4696794
$450.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
Species:
Human
Synonyms:
ABCC6, Abcc6
Insert length:
4512 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4825923
$450.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
Species:
Human
Synonyms:
ABCC6, Abcc6
Insert length:
4512 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4775393
$450.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
Species:
Human
Synonyms:
ABCC6, Abcc6
Insert length:
4512 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4627172
$450.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
Species:
Human
Synonyms:
ABCC6, Abcc6
Insert length:
4512 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4483701
$450.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
Species:
Human
Synonyms:
ABCC6, Abcc6
Insert length:
4512 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4418615
$450.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
Species:
Human
Synonyms:
ABCC6, Abcc6
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-GFP
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5391449
$470.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
Gene ID:
368 (Human, ABCC6)
Synonyms:
ABCC6, Abcc6
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5055059

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5036114
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 6 (ABCC6)
NCBI Accession:
NM_001079528
Species:
Human
Synonyms:
ABCC6, Abcc6
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABCC6
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5228670
$520.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to ABCC6

  • ATP binding cassette subfamily C member 6 (ABCC6)
  • ATP-binding cassette, sub-family C (CFTR/MRP), member 6 (Abcc6)
  • ATP binding cassette subfamily C member 6 (Abcc6)
  • ABC34
  • Abcc1b
  • ARA
  • DCC
  • dyscalc
  • Dyscalc1
  • EST349056
  • GACI2
  • MLP1
  • MOAT-E
  • MOATE
  • MRP6
  • Mrp6
  • PXE
  • PXE1
  • URG7

Gene-IDs for different species

GENE IDSPECIES
368 Homo sapiens
27421 Mus musculus
81642 Rattus norvegicus

Protein level used designations for ABCC6

  • ATP-binding cassette sub-family C member 6
  • anthracycline resistance-associated protein
  • multi-specific organic anion transporter E
  • multidrug resistance-associated protein 6
  • ATP-binding cassette, sub-family C, member 6
  • multidrug resistance-associated protein-6
  • ATP-binding cassette, sub-family C (CFTR/MRP), member 6
  • MLP-1
  • MRP-like protein 1
  • liver multidrug resistance-associated protein 6
Other products related to ABCC6 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com