ABCG4 (ATP-Binding Cassette, Sub-Family G (WHITE), Member 4, ABCG4)

Short Description: The protein encoded by this gene is included in the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily and is expressed predominantly in liver tissue. The function has not yet been determined but may involve cholesterol transport. Alternate splice variants have been described but their full length sequences have not been determined. [provided by RefSeq, Jul 2008].
More information related to gene ABCG4.
Products related to ABCG4 Gene:
96 Products
Type
  • 93
  • 3
Species
  • 41
  • 26
  • 25
  • 2
  • 2
Application
  • 57
  • 22
  • 21
  • 16
Fusion tag
  • 30
  • 17
  • 13
  • 9
  • 8
Vector Backbone
  • 8
  • 8
  • 6
  • 6
  • 6
Vector
  • 39
  • 32
  • 12
  • 9
  • 1
Insert
  • 35
  • 23
  • 19
  • 8
  • 6
Oligo-Type
  • 3
Resistance Gene
  • 37
  • 33
  • 22
  • 2
  • 1
Expression Type
  • 92
  • 48
Selectable Marker
  • 26
  • 24
Promoter
  • 35
  • 29
  • 13
  • 11
  • 8
Format
  • 36
  • 24
  • 24
  • 12
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 4 (ABCG4)
Gene ID:
508443 (Cow (Bovine), ABCG4)
Synonyms:
ABCG4, CpipJ_CPIJ007191, CpipJ_CPIJ012365, CpipJ_CPIJ012372, CpipJ_CPIJ014443, CpipJ_CPIJ019125, CpipJ_CPIJ020198, PAAG_06842, Abcg4, LOC550918, abcg4a, abcg4b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3855878
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 4 (ABCG4)
Gene ID:
64137 (Human, ABCG4)
Synonyms:
ABCG4, CpipJ_CPIJ007191, CpipJ_CPIJ012365, CpipJ_CPIJ012372, CpipJ_CPIJ014443, CpipJ_CPIJ019125, CpipJ_CPIJ020198, PAAG_06842, Abcg4, LOC550918, abcg4a, abcg4b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3819036
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 4 (ABCG4)
Gene ID:
192663 (Mouse (Murine), ABCG4)
Synonyms:
ABCG4, CpipJ_CPIJ007191, CpipJ_CPIJ012365, CpipJ_CPIJ012372, CpipJ_CPIJ014443, CpipJ_CPIJ019125, CpipJ_CPIJ020198, PAAG_06842, Abcg4, LOC550918, abcg4a, abcg4b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3833317
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 4 (ABCG4)
Gene ID:
192663 (Mouse (Murine), ABCG4)
Synonyms:
ABCG4, CpipJ_CPIJ007191, CpipJ_CPIJ012365, CpipJ_CPIJ012372, CpipJ_CPIJ014443, CpipJ_CPIJ019125, CpipJ_CPIJ020198, PAAG_06842, Abcg4, LOC550918, abcg4a, abcg4b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3833318
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 4 (ABCG4)
Gene ID:
64137 (Human, ABCG4)
Synonyms:
ABCG4, CpipJ_CPIJ007191, CpipJ_CPIJ012365, CpipJ_CPIJ012372, CpipJ_CPIJ014443, CpipJ_CPIJ019125, CpipJ_CPIJ020198, PAAG_06842, Abcg4, LOC550918, abcg4a, abcg4b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3819037
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 4 (ABCG4)
Gene ID:
508443 (Cow (Bovine), ABCG4)
Synonyms:
ABCG4, CpipJ_CPIJ007191, CpipJ_CPIJ012365, CpipJ_CPIJ012372, CpipJ_CPIJ014443, CpipJ_CPIJ019125, CpipJ_CPIJ020198, PAAG_06842, Abcg4, LOC550918, abcg4a, abcg4b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3855876
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 4 (ABCG4)
Gene ID:
64137 (Human, ABCG4)
Synonyms:
ABCG4, CpipJ_CPIJ007191, CpipJ_CPIJ012365, CpipJ_CPIJ012372, CpipJ_CPIJ014443, CpipJ_CPIJ019125, CpipJ_CPIJ020198, PAAG_06842, Abcg4, LOC550918, abcg4a, abcg4b
Insert length:
1941 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5320142
$204.60
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 4 (ABCG4)
Species:
Human
Synonyms:
ABCG4, CpipJ_CPIJ007191, CpipJ_CPIJ012365, CpipJ_CPIJ012372, CpipJ_CPIJ014443, CpipJ_CPIJ019125, CpipJ_CPIJ020198, PAAG_06842, Abcg4, LOC550918, abcg4a, abcg4b
Insert length:
1941 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4372126
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 4 (ABCG4)
Species:
Human
Synonyms:
ABCG4, CpipJ_CPIJ007191, CpipJ_CPIJ012365, CpipJ_CPIJ012372, CpipJ_CPIJ014443, CpipJ_CPIJ019125, CpipJ_CPIJ020198, PAAG_06842, Abcg4, LOC550918, abcg4a, abcg4b
Insert length:
1941 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4372557
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 4 (ABCG4)
Species:
Human
Synonyms:
ABCG4, CpipJ_CPIJ007191, CpipJ_CPIJ012365, CpipJ_CPIJ012372, CpipJ_CPIJ014443, CpipJ_CPIJ019125, CpipJ_CPIJ020198, PAAG_06842, Abcg4, LOC550918, abcg4a, abcg4b
Insert length:
1941 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4432754
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 4 (ABCG4)
Species:
Human
Synonyms:
ABCG4, CpipJ_CPIJ007191, CpipJ_CPIJ012365, CpipJ_CPIJ012372, CpipJ_CPIJ014443, CpipJ_CPIJ019125, CpipJ_CPIJ020198, PAAG_06842, Abcg4, LOC550918, abcg4a, abcg4b
Insert length:
1941 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4825937
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 4 (ABCG4)
Species:
Human
Synonyms:
ABCG4, CpipJ_CPIJ007191, CpipJ_CPIJ012365, CpipJ_CPIJ012372, CpipJ_CPIJ014443, CpipJ_CPIJ019125, CpipJ_CPIJ020198, PAAG_06842, Abcg4, LOC550918, abcg4a, abcg4b
Insert length:
1941 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4758034
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 4 (ABCG4)
Species:
Human
Synonyms:
ABCG4, CpipJ_CPIJ007191, CpipJ_CPIJ012365, CpipJ_CPIJ012372, CpipJ_CPIJ014443, CpipJ_CPIJ019125, CpipJ_CPIJ020198, PAAG_06842, Abcg4, LOC550918, abcg4a, abcg4b
Insert length:
1941 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4696808
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 4 (ABCG4)
NCBI Accession:
NM_001142505,NP_001135977
Species:
Human
Synonyms:
ABCG4, CpipJ_CPIJ007191, CpipJ_CPIJ012365, CpipJ_CPIJ012372, CpipJ_CPIJ014443, CpipJ_CPIJ019125, CpipJ_CPIJ020198, PAAG_06842, Abcg4, LOC550918, abcg4a, abcg4b
Insert length:
1941 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5391570
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 4
Species:
Rat (Rattus)
Synonyms:
WHITE2, 6430517O04Rik, zgc:171697
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Abcg4 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3360635
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 4 (ABCG4)
NCBI Accession:
NM_138955
Species:
Mouse (Murine)
Synonyms:
ABCG4, CpipJ_CPIJ007191, CpipJ_CPIJ012365, CpipJ_CPIJ012372, CpipJ_CPIJ014443, CpipJ_CPIJ019125, CpipJ_CPIJ020198, PAAG_06842, Abcg4, LOC550918, abcg4a, abcg4b
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abcg4
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113398
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 4 (ABCG4)
NCBI Accession:
NM_001106816
Species:
Rat (Rattus)
Synonyms:
ABCG4, CpipJ_CPIJ007191, CpipJ_CPIJ012365, CpipJ_CPIJ012372, CpipJ_CPIJ014443, CpipJ_CPIJ019125, CpipJ_CPIJ020198, PAAG_06842, Abcg4, LOC550918, abcg4a, abcg4b
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abcg4
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113400
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 4 (ABCG4)
NCBI Accession:
NM_022169
Species:
Human
Synonyms:
ABCG4, CpipJ_CPIJ007191, CpipJ_CPIJ012365, CpipJ_CPIJ012372, CpipJ_CPIJ014443, CpipJ_CPIJ019125, CpipJ_CPIJ020198, PAAG_06842, Abcg4, LOC550918, abcg4a, abcg4b
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABCG4
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113396
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 4
Species:
Mouse (Murine)
Synonyms:
WHITE2, 6430517O04Rik, zgc:171697
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Abcg4 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3266149
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 4
Gene ID:
64137 (Human, ABCG4)
Synonyms:
WHITE2, 6430517O04Rik, zgc:171697
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5789245
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to ABCG4

  • ATP binding cassette subfamily G member 4 (ABCG4)
  • ATP-binding cassette sub-family G member 4 (CpipJ_CPIJ007191)
  • ATP-binding cassette sub-family G member 4 (CpipJ_CPIJ012365)
  • ATP-binding cassette sub-family G member 4 (CpipJ_CPIJ012372)
  • ATP-binding cassette sub-family G member 4 (CpipJ_CPIJ014443)
  • ATP-binding cassette sub-family G member 4 (CpipJ_CPIJ019125)
  • ATP-binding cassette sub-family G member 4 (CpipJ_CPIJ020198)
  • ATP-binding cassette sub-family G member 4 (PAAG_06842)
  • ATP binding cassette subfamily G member 4 (Abcg4)
  • ATP-binding cassette sub-family G member 4 (LOC550918)
  • ATP-binding cassette, sub-family G (WHITE), member 4a (abcg4a)
  • ATP-binding cassette, sub-family G (WHITE), member 4b (abcg4b)
  • 6430517O04Rik
  • WHITE2
  • zgc:171697

Gene-IDs for different species

GENE IDSPECIES
64137 Homo sapiens
6039746 Culex quinquefasciatus
6046116 Culex quinquefasciatus
6046125 Culex quinquefasciatus
6047536 Culex quinquefasciatus
6053250 Culex quinquefasciatus
6054483 Culex quinquefasciatus
9094554 Paracoccidioides sp. 'lutzii' Pb01
466802 Pan troglodytes
508443 Bos taurus
192663 Mus musculus
300664 Rattus norvegicus
428242 Gallus gallus
550918 Apis mellifera
564842 Danio rerio
100338027 Oryctolagus cuniculus
100451383 Pongo abelii
100518504 Sus scrofa
610604 Canis lupus familiaris
100550413 Meleagris gallopavo
100595528 Nomascus leucogenys
794238 Danio rerio

Protein level used designations for ABCG4

  • ATP-binding cassette sub-family G member 4
  • ATP-binding cassette, subfamily G, member 4
  • putative ABC transporter
  • ATP-binding cassette, sub-family G (WHITE), member 4
  • ATP-binding cassette, subfamily G, member 4-like
  • ATP-binding cassette sub-family G member 4-like
  • ATP-binding cassette, sub-family G (WHITE), member 4b
Other products related to ABCG4 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com