ABHD13 (Abhydrolase Domain Containing 13, ABHD13)

Products related to ABHD13 Gene:
146 Products
Type
  • 140
  • 6
Species
  • 59
  • 41
  • 24
  • 14
  • 2
Oligo-Type
  • 5
  • 1
Insert
  • 55
  • 49
  • 20
  • 8
  • 6
Vector
  • 65
  • 36
  • 16
  • 11
  • 9
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Fusion tag
  • 52
  • 16
  • 15
  • 10
  • 8
Resistance Gene
  • 67
  • 47
  • 20
  • 6
  • 2
Selectable Marker
  • 30
  • 26
  • 26
  • 1
Promoter
  • 42
  • 34
  • 30
  • 17
  • 8
Expression Type
  • 104
  • 53
  • 26
  • 2
Application
  • 87
  • 39
  • 25
  • 16
  • 1
Format
  • 68
  • 36
  • 22
  • 20
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
Abhydrolase Domain Containing 13 (ABHD13)
Species:
Human
Synonyms:
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5720707
€39.82
1 μg
Plus shipping costs €45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Full length Clone DNA of Mus musculus abhydrolase domain containing 13.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 13 (ABHD13)
NCBI Accession:
NM_026868
Species:
Mouse (Murine)
Synonyms:
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545856
€66.37
1 vial
Plus shipping costs €45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) abhydrolase domain containing 13.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 13 (ABHD13)
NCBI Accession:
XM_005586223
Species:
Cynomolgus
Synonyms:
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545857
€66.37
1 vial
Plus shipping costs €45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens abhydrolase domain containing 13

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 13 (ABHD13)
NCBI Accession:
NM_032859
Species:
Human
Synonyms:
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545858
€66.37
1 vial
Plus shipping costs €45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Rattus norvegicus abhydrolase domain containing 13

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 13 (ABHD13)
NCBI Accession:
NM_001271072
Species:
Rat (Rattus)
Synonyms:
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545859
€66.37
1 vial
Plus shipping costs €45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Verified forward and reverse primers for analyzing the quantitative expression of gene

Application:
Quantitative real-time PCR
Gene:
Abhydrolase Domain Containing 13
Species:
Mouse (Murine)
Synonyms:
BEM46L1, C13orf6, RP11-153I24.2, bA153I24.2, 1110065L07Rik, AI463703, AI788994, RGD1308317, zgc:123286
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3195103
€69.91
1 vial
Plus shipping costs €45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Full length Homo sapiens abhydrolase domain containing 13 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 13 (ABHD13)
Gene ID:
84945 (Human, ABHD13)
Synonyms:
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3470009
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens abhydrolase domain containing 13 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 13 (ABHD13)
Gene ID:
84945 (Human, ABHD13)
Synonyms:
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4039396
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus abhydrolase domain containing 13 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 13 (ABHD13)
Gene ID:
68904 (Mouse (Murine), ABHD13)
Synonyms:
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3822722
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus laevis abhydrolase domain containing 13 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 13 (ABHD13)
Gene ID:
432053 (Xenopus laevis, ABHD13)
Synonyms:
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3848538
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Bos taurus abhydrolase domain containing 13 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 13 (ABHD13)
Gene ID:
513848 (Cow (Bovine), ABHD13)
Synonyms:
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4062742
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens abhydrolase domain containing 13 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 13 (ABHD13)
Gene ID:
84945 (Human, ABHD13)
Synonyms:
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3470010
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens abhydrolase domain containing 13 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 13 (ABHD13)
Gene ID:
84945 (Human, ABHD13)
Synonyms:
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4039397
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus abhydrolase domain containing 13 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 13 (ABHD13)
Gene ID:
68904 (Mouse (Murine), ABHD13)
Synonyms:
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3822724
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus laevis abhydrolase domain containing 13 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 13 (ABHD13)
Gene ID:
432053 (Xenopus laevis, ABHD13)
Synonyms:
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3848537
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Bos taurus abhydrolase domain containing 13 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 13 (ABHD13)
Gene ID:
513848 (Cow (Bovine), ABHD13)
Synonyms:
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4062743
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

Type:
ORF
Application:
Cloning
Gene:
Abhydrolase Domain Containing 13 (ABHD13)
Gene ID:
84945 (Human, ABHD13)
Synonyms:
ABHD13, abhd13, abhd13.S, Abhd13
Insert length:
606 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5314085
€163.24
2 μg
Plus shipping costs €45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ABHD13 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 13 (ABHD13)
NCBI Accession:
NM_032859,NP_116248
Species:
Human
Synonyms:
ABHD13, abhd13, abhd13.S, Abhd13
Insert length:
1330 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3382316
€168.14
10 μg
Plus shipping costs €45.00
Delivery in 8 to 11 Business Days
Supplier: Log in to see

Mammalian expression of Human ABHD13 with HA tag

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 13 (ABHD13)
Species:
Human
Synonyms:
ABHD13, abhd13, abhd13.S, Abhd13
Insert length:
1014 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4471665
€243.36
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ABHD13 with His-MBP

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 13 (ABHD13)
Species:
Human
Synonyms:
ABHD13, abhd13, abhd13.S, Abhd13
Insert length:
1014 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4696816
€243.36
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ABHD13

  • abhydrolase domain containing 13 (ABHD13)
  • abhydrolase domain containing 13 (abhd13)
  • abhydrolase domain containing 13 S homeolog (abhd13.S)
  • abhydrolase domain containing 13 (Abhd13)
  • 1110065L07Rik
  • AI463703
  • AI788994
  • bA153I24.2
  • BEM46L1
  • C13orf6
  • RGD1308317
  • RP11-153I24.2
  • zgc:123286

Gene-IDs for different species

GENE IDSPECIES
467322 Pan troglodytes
695701 Macaca mulatta
100127876 Xenopus (Silurana) tropicalis
100154680 Sus scrofa
100601873 Nomascus leucogenys
432053 Xenopus laevis
418763 Gallus gallus
84945 Homo sapiens
513848 Bos taurus
68904 Mus musculus
306630 Rattus norvegicus
561333 Danio rerio
100718895 Cavia porcellus
101116488 Ovis aries

Protein level used designations for ABHD13

  • abhydrolase domain containing 13
  • abhydrolase domain-containing protein 13
  • alpha/beta hydrolase domain-containing protein 13
Other products related to ABHD13 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com