ABHD13 (Abhydrolase Domain Containing 13, ABHD13)

Products related to ABHD13 Gene:
146 Products
  • 140
  • 6
  • 59
  • 41
  • 24
  • 14
  • 2
  • 87
  • 39
  • 25
  • 16
  • 1
Fusion tag
  • 52
  • 16
  • 15
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
  • 65
  • 36
  • 16
  • 11
  • 9
  • 55
  • 49
  • 20
  • 8
  • 6
  • 5
  • 1
Resistance Gene
  • 67
  • 47
  • 20
  • 6
  • 2
Expression Type
  • 104
  • 53
  • 26
  • 2
Selectable Marker
  • 30
  • 26
  • 26
  • 1
  • 42
  • 34
  • 30
  • 17
  • 8
  • 68
  • 36
  • 22
  • 20

Protein Expression, Cloning
Abhydrolase Domain Containing 13 (ABHD13)
Gene ID:
68904 (Mouse (Murine), ABHD13)
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3822722
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Abhydrolase Domain Containing 13 (ABHD13)
Gene ID:
432053 (Xenopus laevis, ABHD13)
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3848538
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Abhydrolase Domain Containing 13 (ABHD13)
Gene ID:
513848 (Cow (Bovine), ABHD13)
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4062742
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Abhydrolase Domain Containing 13 (ABHD13)
Gene ID:
84945 (Human, ABHD13)
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4039396
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Abhydrolase Domain Containing 13 (ABHD13)
Gene ID:
84945 (Human, ABHD13)
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3470009
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Abhydrolase Domain Containing 13 (ABHD13)
NCBI Accession:
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3545857
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Abhydrolase Domain Containing 13 (ABHD13)
NCBI Accession:
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3545858
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Abhydrolase Domain Containing 13 (ABHD13)
NCBI Accession:
Mouse (Murine)
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3545856
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Abhydrolase Domain Containing 13 (ABHD13)
NCBI Accession:
Rat (Rattus)
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3545859
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Quantitative real-time PCR
Abhydrolase Domain Containing 13
Mouse (Murine)
BEM46L1, C13orf6, RP11-153I24.2, bA153I24.2, 1110065L07Rik, AI463703, AI788994, RGD1308317, zgc:123286
-20 °C
Catalog No. ABIN3195103
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Abhydrolase Domain Containing 13 (ABHD13)
ABHD13, abhd13, abhd13.S, Abhd13
Insert length:
1014 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5720707
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression, Cloning
Abhydrolase Domain Containing 13 (ABHD13)
Gene ID:
68904 (Mouse (Murine), ABHD13)
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3822724
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Abhydrolase Domain Containing 13 (ABHD13)
Gene ID:
432053 (Xenopus laevis, ABHD13)
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3848537
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Abhydrolase Domain Containing 13 (ABHD13)
Gene ID:
513848 (Cow (Bovine), ABHD13)
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4062743
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Abhydrolase Domain Containing 13 (ABHD13)
Gene ID:
84945 (Human, ABHD13)
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4039397
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Abhydrolase Domain Containing 13 (ABHD13)
Gene ID:
84945 (Human, ABHD13)
ABHD13, abhd13, abhd13.S, Abhd13
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3470010
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Abhydrolase Domain Containing 13 (ABHD13)
Gene ID:
84945 (Human, ABHD13)
ABHD13, abhd13, abhd13.S, Abhd13
Insert length:
606 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5314085
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Protein Expression
Abhydrolase Domain Containing 13 (ABHD13)
ABHD13, abhd13, abhd13.S, Abhd13
Insert length:
1014 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4432760
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Abhydrolase Domain Containing 13 (ABHD13)
NCBI Accession:
ABHD13, abhd13, abhd13.S, Abhd13
Insert length:
1330 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3382316
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Abhydrolase Domain Containing 13 (ABHD13)
ABHD13, abhd13, abhd13.S, Abhd13
Insert length:
1014 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4372132
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ABHD13

  • abhydrolase domain containing 13 (ABHD13)
  • abhydrolase domain containing 13 (abhd13)
  • abhydrolase domain containing 13 S homeolog (abhd13.S)
  • abhydrolase domain containing 13 (Abhd13)
  • 1110065L07Rik
  • AI463703
  • AI788994
  • bA153I24.2
  • BEM46L1
  • C13orf6
  • RGD1308317
  • RP11-153I24.2
  • zgc:123286

Gene-IDs for different species

467322 Pan troglodytes
695701 Macaca mulatta
100127876 Xenopus (Silurana) tropicalis
100154680 Sus scrofa
100601873 Nomascus leucogenys
432053 Xenopus laevis
418763 Gallus gallus
84945 Homo sapiens
513848 Bos taurus
68904 Mus musculus
306630 Rattus norvegicus
561333 Danio rerio
100718895 Cavia porcellus
101116488 Ovis aries

Protein level used designations for ABHD13

  • abhydrolase domain containing 13
  • abhydrolase domain-containing protein 13
  • alpha/beta hydrolase domain-containing protein 13
Other products related to ABHD13 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com