ABHD14B (Abhydrolase Domain Containing 14B, ABHD14B)

Short Description: Has hydrolase activity towards p-nitrophenyl butyrate (in vitro). May activate transcription (By similarity).
More information related to gene ABHD14B.
Products related to ABHD14B Gene:
131 Products
Type
  • 126
  • 5
Species
  • 65
  • 29
  • 27
  • 4
  • 2
Application
  • 83
  • 35
  • 24
  • 16
  • 1
Fusion tag
  • 48
  • 19
  • 14
  • 11
  • 8
Vector Backbone
  • 8
  • 8
  • 7
  • 6
  • 6
Vector
  • 57
  • 40
  • 12
  • 9
  • 5
Insert
  • 46
  • 44
  • 20
  • 8
  • 6
Oligo-Type
  • 4
  • 1
Resistance Gene
  • 50
  • 47
  • 24
  • 5
  • 2
Expression Type
  • 108
  • 53
  • 13
  • 2
Selectable Marker
  • 28
  • 26
  • 13
  • 1
Promoter
  • 39
  • 33
  • 30
  • 12
  • 8
Format
  • 56
  • 27
  • 24
  • 24
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
Abhydrolase Domain Containing 14B (ABHD14B)
Species:
Human
Synonyms:
Abhd14b, ABHD14B, abhd14b.L, abhd14b
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5744877
$70.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human abhydrolase domain containing 14B (ABHD14B) transcript variant 1

Type:
ORF
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 14B (ABHD14B)
NCBI Accession:
NM_032750,NP_116139
Species:
Human
Synonyms:
Abhd14b, ABHD14B, abhd14b.L, abhd14b
Insert length:
633 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5415824
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Full length Danio rerio zgc:64031 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 14B (ABHD14B)
Gene ID:
393338 (Zebrafish (Danio rerio), ABHD14B)
Synonyms:
Abhd14b, ABHD14B, abhd14b.L, abhd14b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3877469
$99.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus abhydrolase domain containing 14b cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 14B (ABHD14B)
Gene ID:
76491 (Mouse (Murine), ABHD14B)
Synonyms:
Abhd14b, ABHD14B, abhd14b.L, abhd14b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3825911
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Rattus norvegicus abhydrolase domain containing 14b cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 14B (ABHD14B)
Gene ID:
300983 (Rat (Rattus), ABHD14B)
Synonyms:
Abhd14b, ABHD14B, abhd14b.L, abhd14b
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4051636
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens abhydrolase domain containing 14B cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 14B (ABHD14B)
Gene ID:
84836 (Human, ABHD14B)
Synonyms:
Abhd14b, ABHD14B, abhd14b.L, abhd14b
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4093925
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus laevis abhydrolase domain containing 14B cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 14B (ABHD14B)
Gene ID:
379597 (Xenopus laevis, ABHD14B)
Synonyms:
Abhd14b, ABHD14B, abhd14b.L, abhd14b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3842712
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens abhydrolase domain containing 14B cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 14B (ABHD14B)
Gene ID:
84836 (Human, ABHD14B)
Synonyms:
Abhd14b, ABHD14B, abhd14b.L, abhd14b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3828207
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Bos taurus abhydrolase domain containing 14B cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 14B (ABHD14B)
Gene ID:
615289 (Cow (Bovine), ABHD14B)
Synonyms:
Abhd14b, ABHD14B, abhd14b.L, abhd14b
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4067094
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens abhydrolase domain containing 14B.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 14B (ABHD14B)
Species:
Human
Synonyms:
Abhd14b, ABHD14B, abhd14b.L, abhd14b
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545862
$125.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Verified forward and reverse primers for analyzing the quantitative expression of gene

Application:
Quantitative real-time PCR
Gene:
Abhydrolase Domain Containing 14B
Species:
Human
Synonyms:
1810013B01Rik, CIB, MGC68600, zgc:64031
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3190912
$129.00
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Danio rerio zgc:64031 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 14B (ABHD14B)
Gene ID:
393338 (Zebrafish (Danio rerio), ABHD14B)
Synonyms:
Abhd14b, ABHD14B, abhd14b.L, abhd14b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3844849
$139.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus abhydrolase domain containing 14b cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 14B (ABHD14B)
Gene ID:
76491 (Mouse (Murine), ABHD14B)
Synonyms:
Abhd14b, ABHD14B, abhd14b.L, abhd14b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3825912
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Rattus norvegicus abhydrolase domain containing 14b cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 14B (ABHD14B)
Gene ID:
300983 (Rat (Rattus), ABHD14B)
Synonyms:
Abhd14b, ABHD14B, abhd14b.L, abhd14b
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4051637
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens abhydrolase domain containing 14B cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 14B (ABHD14B)
Gene ID:
84836 (Human, ABHD14B)
Synonyms:
Abhd14b, ABHD14B, abhd14b.L, abhd14b
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4093924
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus laevis abhydrolase domain containing 14B cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 14B (ABHD14B)
Gene ID:
379597 (Xenopus laevis, ABHD14B)
Synonyms:
Abhd14b, ABHD14B, abhd14b.L, abhd14b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3842713
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens abhydrolase domain containing 14B cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 14B (ABHD14B)
Gene ID:
84836 (Human, ABHD14B)
Synonyms:
Abhd14b, ABHD14B, abhd14b.L, abhd14b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3828206
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Bos taurus abhydrolase domain containing 14B cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 14B (ABHD14B)
Gene ID:
615289 (Cow (Bovine), ABHD14B)
Synonyms:
Abhd14b, ABHD14B, abhd14b.L, abhd14b
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4067095
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

Type:
ORF
Application:
Cloning
Gene:
Abhydrolase Domain Containing 14B (ABHD14B)
Gene ID:
84836 (Human, ABHD14B)
Synonyms:
Abhd14b, ABHD14B, abhd14b.L, abhd14b
Insert length:
633 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5311760
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Bacterial expression of Human ABHD14B with His tag

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 14B (ABHD14B)
Species:
Human
Synonyms:
Abhd14b, ABHD14B, abhd14b.L, abhd14b
Insert length:
633 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4372134
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ABHD14B

  • abhydrolase domain containing 14b (Abhd14b)
  • abhydrolase domain containing 14B (ABHD14B)
  • abhydrolase domain containing 14B L homeolog (abhd14b.L)
  • abhydrolase domain containing 14B (abhd14b)
  • abhydrolase domain containing 14B (Abhd14b)
  • 1810013B01Rik
  • CIB
  • MGC68600
  • zgc:64031

Gene-IDs for different species

GENE IDSPECIES
76491 Mus musculus
84836 Homo sapiens
300983 Rattus norvegicus
379597 Xenopus laevis
460411 Pan troglodytes
484744 Canis lupus familiaris
550030 Xenopus (Silurana) tropicalis
615289 Bos taurus
698910 Macaca mulatta
100437476 Pongo abelii
100714050 Cavia porcellus
101114818 Ovis aries
393338 Danio rerio

Protein level used designations for ABHD14B

  • CCG1-interacting factor B
  • abhydrolase domain-containing protein 14B
  • alpha/beta hydrolase domain-containing protein 14B
  • cell cycle gene 1-interacting factor B
  • abhydrolase domain containing 14B
  • Abhydrolase domain-containing protein 14B
  • protein ABHD14B
Other products related to ABHD14B such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com