ABTB1 (Ankyrin Repeat and BTB (POZ) Domain Containing 1, ABTB1)

Short Description: This gene encodes a protein with an ankyrin repeat region and two BTB/POZ domains, which are thought to be involved in protein-protein interactions. Expression of this gene is activated by the phosphatase and tensin homolog, a tumor suppressor. Alternate splicing results in three transcript variants. [provided by RefSeq, Mar 2010].
More information related to gene ABTB1.
Products related to ABTB1 Gene:
132 Products
Type
  • 124
  • 8
Species
  • 52
  • 44
  • 30
  • 2
  • 2
Oligo-Type
  • 6
  • 2
Insert
  • 47
  • 40
  • 21
  • 8
  • 6
Vector
  • 60
  • 34
  • 12
  • 9
  • 5
Vector Backbone
  • 6
  • 6
  • 6
  • 5
  • 5
Fusion tag
  • 46
  • 15
  • 13
  • 9
  • 8
Resistance Gene
  • 57
  • 44
  • 18
  • 5
  • 2
Selectable Marker
  • 26
  • 26
  • 25
  • 1
Promoter
  • 41
  • 31
  • 30
  • 13
  • 8
Expression Type
  • 92
  • 51
  • 26
  • 2
Application
  • 79
  • 30
  • 27
  • 16
  • 2
Format
  • 67
  • 27
  • 20
  • 18
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
Ankyrin Repeat and BTB (POZ) Domain Containing 1 (ABTB1)
Species:
Human
Synonyms:
ABTB1, abtb1.S, abtb1, Abtb1
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5733107
$45.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens ankyrin repeat and BTB (POZ) domain containing 1.

Type:
cDNA
Application:
Cloning
Gene:
Ankyrin Repeat and BTB (POZ) Domain Containing 1 (ABTB1)
Species:
Human
Synonyms:
ABTB1, abtb1.S, abtb1, Abtb1
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545880
$75.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Mus musculus ankyrin repeat and BTB (POZ) domain containing 1.

Type:
cDNA
Application:
Cloning
Gene:
Ankyrin Repeat and BTB (POZ) Domain Containing 1 (ABTB1)
NCBI Accession:
NM_030251
Species:
Mouse (Murine)
Synonyms:
ABTB1, abtb1.S, abtb1, Abtb1
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611091
$75.00
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Verified forward and reverse primers for analyzing the quantitative expression of gene

Application:
Quantitative real-time PCR
Gene:
Ankyrin Repeat and BTB (POZ) Domain Containing 1
Species:
Mouse (Murine)
Synonyms:
abtb1, MGC80260, ABTB1, MGC122091, BPOZ, BTB3, BTBD21, EF1ABP, AI847549, BC003234
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194957
$79.00
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Verified forward and reverse primers for analyzing the quantitative expression of gene

Application:
Quantitative real-time PCR
Gene:
Ankyrin Repeat and BTB (POZ) Domain Containing 1
Species:
Human
Synonyms:
abtb1, MGC80260, ABTB1, MGC122091, BPOZ, BTB3, BTBD21, EF1ABP, AI847549, BC003234
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3191800
$79.00
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Full length Xenopus tropicalis ankyrin repeat and BTB (POZ) domain containing 1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ankyrin Repeat and BTB (POZ) Domain Containing 1 (ABTB1)
Gene ID:
100124760 (Xenopus tropicalis, ABTB1)
Synonyms:
ABTB1, abtb1.S, abtb1, Abtb1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4031650
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Rattus norvegicus ankyrin repeat and BTB (POZ) domain containing 1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ankyrin Repeat and BTB (POZ) Domain Containing 1 (ABTB1)
Gene ID:
297432 (Rat (Rattus), ABTB1)
Synonyms:
ABTB1, abtb1.S, abtb1, Abtb1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4051012
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus ankyrin repeat and BTB (POZ) domain containing 1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ankyrin Repeat and BTB (POZ) Domain Containing 1 (ABTB1)
Gene ID:
80283 (Mouse (Murine), ABTB1)
Synonyms:
ABTB1, abtb1.S, abtb1, Abtb1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3827046
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus laevis ankyrin repeat and BTB (POZ) domain containing 1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ankyrin Repeat and BTB (POZ) Domain Containing 1 (ABTB1)
Gene ID:
432301 (Xenopus laevis, ABTB1)
Synonyms:
ABTB1, abtb1.S, abtb1, Abtb1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3848906
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens ankyrin repeat and BTB (POZ) domain containing 1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Ankyrin Repeat and BTB (POZ) Domain Containing 1 (ABTB1)
Gene ID:
80325 (Human, ABTB1)
Synonyms:
ABTB1, abtb1.S, abtb1, Abtb1
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4093338
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Bos taurus ankyrin repeat and BTB (POZ) domain containing 1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ankyrin Repeat and BTB (POZ) Domain Containing 1 (ABTB1)
Gene ID:
507417 (Cow (Bovine), ABTB1)
Synonyms:
ABTB1, abtb1.S, abtb1, Abtb1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4061614
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus tropicalis ankyrin repeat and BTB (POZ) domain containing 1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ankyrin Repeat and BTB (POZ) Domain Containing 1 (ABTB1)
Gene ID:
100124760 (Xenopus tropicalis, ABTB1)
Synonyms:
ABTB1, abtb1.S, abtb1, Abtb1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4031651
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Rattus norvegicus ankyrin repeat and BTB (POZ) domain containing 1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ankyrin Repeat and BTB (POZ) Domain Containing 1 (ABTB1)
Gene ID:
297432 (Rat (Rattus), ABTB1)
Synonyms:
ABTB1, abtb1.S, abtb1, Abtb1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4051013
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus ankyrin repeat and BTB (POZ) domain containing 1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ankyrin Repeat and BTB (POZ) Domain Containing 1 (ABTB1)
Gene ID:
80283 (Mouse (Murine), ABTB1)
Synonyms:
ABTB1, abtb1.S, abtb1, Abtb1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3827045
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus laevis ankyrin repeat and BTB (POZ) domain containing 1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ankyrin Repeat and BTB (POZ) Domain Containing 1 (ABTB1)
Gene ID:
432301 (Xenopus laevis, ABTB1)
Synonyms:
ABTB1, abtb1.S, abtb1, Abtb1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3848907
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens ankyrin repeat and BTB (POZ) domain containing 1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Ankyrin Repeat and BTB (POZ) Domain Containing 1 (ABTB1)
Gene ID:
80325 (Human, ABTB1)
Synonyms:
ABTB1, abtb1.S, abtb1, Abtb1
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4093339
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Bos taurus ankyrin repeat and BTB (POZ) domain containing 1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ankyrin Repeat and BTB (POZ) Domain Containing 1 (ABTB1)
Gene ID:
507417 (Cow (Bovine), ABTB1)
Synonyms:
ABTB1, abtb1.S, abtb1, Abtb1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4061613
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ABTB1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Ankyrin Repeat and BTB (POZ) Domain Containing 1 (ABTB1)
NCBI Accession:
NM_172027,NP_742024
Species:
Human
Synonyms:
ABTB1, abtb1.S, abtb1, Abtb1
Insert length:
1830 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3382323
$190.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 11 Business Days
Supplier: Log in to see

Full length Clone DNA of Mus musculus ankyrin repeat and BTB (POZ) domain containing 1 with N terminal HA tag.

Type:
ORF
Application:
Protein Expression
Gene:
Ankyrin Repeat and BTB (POZ) Domain Containing 1 (ABTB1)
NCBI Accession:
NM_030251
Species:
Mouse (Murine)
Synonyms:
ABTB1, abtb1.S, abtb1, Abtb1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948167

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611082
$195.00
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens ankyrin repeat and BTB (POZ) domain containing 1 with C terminal His tag.

Type:
ORF
Application:
Protein Expression
Gene:
Ankyrin Repeat and BTB (POZ) Domain Containing 1 (ABTB1)
Species:
Human
Synonyms:
ABTB1, abtb1.S, abtb1, Abtb1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611071
$195.00
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to ABTB1

  • ankyrin repeat and BTB domain containing 1 (ABTB1)
  • ankyrin repeat and BTB (POZ) domain containing 1 S homeolog (abtb1.S)
  • ankyrin repeat and BTB (POZ) domain containing 1 (abtb1)
  • ankyrin repeat and BTB (POZ) domain containing 1 (Abtb1)
  • ankyrin repeat and BTB domain containing 1 (Abtb1)
  • abtb1
  • ABTB1
  • AI847549
  • BC003234
  • BPOZ
  • BTB3
  • BTBD21
  • EF1ABP
  • MGC80260
  • MGC122091

Gene-IDs for different species

GENE IDSPECIES
416026 Gallus gallus
432301 Xenopus laevis
471067 Pan troglodytes
507417 Bos taurus
100049815 Equus caballus
100124760 Xenopus (Silurana) tropicalis
100223102 Taeniopygia guttata
100413977 Callithrix jacchus
100431840 Pongo abelii
100482337 Ailuropoda melanoleuca
100016927 Monodelphis domestica
100601361 Nomascus leucogenys
100623950 Sus scrofa
80325 Homo sapiens
609299 Canis lupus familiaris
80283 Mus musculus
297432 Rattus norvegicus

Protein level used designations for ABTB1

  • ankyrin repeat and BTB/POZ domain-containing protein 1
  • ankyrin repeat and BTB (POZ) domain containing 1
  • ankyrin repeat and BTB/POZ domain-containing protein 1-like
  • elongation factor 1A-binding protein
  • mFLJ00331 protein
Other products related to ABTB1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com