ACAA1B (Acetyl-Coenzyme A Acyltransferase 1B, ACAA1B)

Products related to ACAA1B Gene:
63 Products
  • 59
  • 4
  • 43
  • 20
  • 4
  • 22
  • 20
  • 8
  • 5
  • 4
  • 29
  • 17
  • 8
  • 3
  • 2
Vector Backbone
  • 4
  • 4
  • 3
  • 3
  • 2
Fusion tag
  • 21
  • 8
  • 7
  • 4
  • 4
Resistance Gene
  • 32
  • 18
  • 8
  • 1
Selectable Marker
  • 15
  • 13
  • 10
  • 19
  • 16
  • 15
  • 8
  • 4
Expression Type
  • 45
  • 24
  • 13
  • 40
  • 14
  • 12
  • 9
  • 28
  • 17
  • 13
  • 5
Supplier: Log in to see

Full length Clone DNA of Mus musculus acetyl-Coenzyme A acyltransferase 1B

Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
Mouse (Murine)
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3545882
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Mus musculus acetyl-Coenzyme A acyltransferase 1B cDNA clone.

Protein Expression, Cloning
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
Gene ID:
235674 (Mouse (Murine), ACAA1B)
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3837292
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Rattus norvegicus acetyl-Coenzyme A acyltransferase 1B cDNA clone.

Protein Expression, Cloning
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
Gene ID:
501072 (Rat (Rattus), ACAA1B)
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4060944
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus acetyl-Coenzyme A acyltransferase 1B cDNA clone.

Protein Expression, Cloning
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
Gene ID:
235674 (Mouse (Murine), ACAA1B)
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3837290
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Rattus norvegicus acetyl-Coenzyme A acyltransferase 1B cDNA clone.

Protein Expression, Cloning
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
Gene ID:
501072 (Rat (Rattus), ACAA1B)
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4060943
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

RNA Interference
Acetyl-Coenzyme A Acyltransferase 1B
Mouse (Murine)
HPLC purified
Available with shipment
  • Acaa1b (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3270128
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Rat Acaa1b is ideal for over-expression of native protein for functional studies.

Protein Expression
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
Rat (Rattus)
Insert length:
1275 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3308456
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

RNA Interference
Acetyl-Coenzyme A Acyltransferase 1B
Rat (Rattus)
HPLC purified
Available with shipment
  • RGD1562373 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3315815
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Individual gRNA against Acaa1b in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Genome Editing with Engineered Nucleases, Protein Expression
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
Mouse (Murine)
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Acaa1b
Viral Particles
-80 °C
Catalog No. ABIN5181534
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

Individual gRNA against RGD1562373 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Genome Editing with Engineered Nucleases, Protein Expression
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
Rat (Rattus)
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of RGD1562373
Viral Particles
-80 °C
Catalog No. ABIN5181536
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
Mouse (Murine)
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5771602
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

siRNA to inhibit ACAA1B expression using RNA interference.

RNA Interference
Acetyl-Coenzyme A Acyltransferase 1B
Gene ID:
501072 (Rat (Rattus), ACAA1B)
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
-20 °C
Catalog No. ABIN5805123
15 nmol
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

siRNA to inhibit ACAA1B expression using RNA interference.

RNA Interference
Acetyl-Coenzyme A Acyltransferase 1B
Gene ID:
235674 (Mouse (Murine), ACAA1B)
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
-20 °C
Catalog No. ABIN5805124
15 nmol
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

Individual gRNA against Acaa1b in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (sgRNA and Cas9 in a single vector)

gRNA + Cas9
Genome Editing with Engineered Nucleases, Protein Expression
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
Mouse (Murine)
Vector type:
Lentiviral Vector
Resistance Gene:
Selection Marker:
U6 Promoter, SFFV Promoter
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Acaa1b
Viral Particles
-80 °C
Catalog No. ABIN5297145
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

Individual gRNA against RGD1562373 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (sgRNA and Cas9 in a single vector)

gRNA + Cas9
Genome Editing with Engineered Nucleases, Protein Expression
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
Rat (Rattus)
Vector type:
Lentiviral Vector
Resistance Gene:
Selection Marker:
U6 Promoter, SFFV Promoter
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of RGD1562373
Viral Particles
-80 °C
Catalog No. ABIN5297147
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

Mammalian expression of Rat RGD1562373 with DYKDDDDK Tag,HA tag

Protein Expression
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
Rat (Rattus)
Insert length:
1580 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4554684
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Mouse Acaa1b with His tag

Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
Mouse (Murine)
Insert length:
1275 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4636042
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Rat RGD1562373 with His tag

Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
Rat (Rattus)
Insert length:
1275 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4813429
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Rat RGD1562373 with His-MBP

Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
Rat (Rattus)
Insert length:
1580 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4753502
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Mouse Acaa1b with His tag

Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
Mouse (Murine)
Insert length:
1275 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4784263
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ACAA1B

  • acetyl-Coenzyme A acyltransferase 1B (Acaa1b)

Gene-IDs for different species

235674 Mus musculus

Protein level used designations for ACAA1B

  • 3-ketoacyl-CoA thiolase B, peroxisomal
  • acetyl-CoA acyltransferase B
  • beta-ketothiolase B
  • peroxisomal 3-oxoacyl-CoA thiolase B
  • thiolase B
Other products related to ACAA1B such as antibodies, ELISA kits and high-purity proteins are available on our partner website