ACAA1B (Acetyl-Coenzyme A Acyltransferase 1B, ACAA1B)

Products related to ACAA1B Gene:
Type
  • 55
  • 2
Species
  • 40
  • 17
Application
  • 38
  • 12
  • 9
  • 8
Fusion tag
  • 17
  • 8
  • 5
  • 4
  • 4
Vector Backbone
  • 4
  • 4
  • 3
  • 3
  • 2
Vector
  • 25
  • 17
  • 8
  • 3
  • 2
Insert
  • 20
  • 20
  • 6
  • 5
  • 4
Oligo-Type
  • 2
Resistance Gene
  • 30
  • 16
  • 8
  • 1
Expression Type
  • 41
  • 22
  • 13
Selectable Marker
  • 13
  • 13
  • 10
Promoter
  • 17
  • 14
  • 13
  • 8
  • 4
Format
  • 24
  • 17
  • 13
  • 3
57 Products

Type:
cDNA
Application:
Cloning
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_146230
Species:
Mouse
Synonyms:
Acaa1b
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545882
$158.97
1 vial
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
Gene ID:
235674 (Mouse, ACAA1B)
Synonyms:
Acaa1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3837290
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
Gene ID:
501072 (Rat, ACAA1B)
Synonyms:
Acaa1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4060943
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_001040019
Species:
Rat
Synonyms:
Acaa1b
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of RGD1562373
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5181536
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_146230
Species:
Mouse
Synonyms:
Acaa1b
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Acaa1b
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5181534
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
cDNA
Application:
Protein Expression
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_001040019,NP_001035108
Species:
Rat
Synonyms:
Acaa1b
Insert length:
1275 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308456
$430.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Application:
RNA Interference
Gene:
Acetyl-Coenzyme A Acyltransferase 1B
Species:
Mouse
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Acaa1b (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3270128
$440.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Acetyl-Coenzyme A Acyltransferase 1B
Species:
Rat
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • RGD1562373 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3315815
$440.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_146230
Species:
Mouse
Synonyms:
Acaa1b
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Acaa1b
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5297145
$520.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_001040019
Species:
Rat
Synonyms:
Acaa1b
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of RGD1562373
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5297147
$520.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
cDNA
Application:
Protein Expression
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_001040019
Species:
Rat
Synonyms:
Acaa1b
Insert length:
1275 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4382341
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_146230
Species:
Mouse
Synonyms:
Acaa1b
Insert length:
1669 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4517637
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_146230
Species:
Mouse
Synonyms:
Acaa1b
Insert length:
1669 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4578844
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_146230
Species:
Mouse
Synonyms:
Acaa1b
Insert length:
1669 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4716392
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_146230
Species:
Mouse
Synonyms:
Acaa1b
Insert length:
1669 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4845523
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_001040019
Species:
Rat
Synonyms:
Acaa1b
Insert length:
1275 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4813429
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_001040019
Species:
Rat
Synonyms:
Acaa1b
Insert length:
1580 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4753502
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_001040019
Species:
Rat
Synonyms:
Acaa1b
Insert length:
1580 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4692245
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_001040019
Species:
Rat
Synonyms:
Acaa1b
Insert length:
1580 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4554684
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_001040019
Species:
Rat
Synonyms:
Acaa1b
Insert length:
1580 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4615863
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ACAA1B

  • acetyl-Coenzyme A acyltransferase 1B (Acaa1b)

Gene-IDs for different species

GENE IDSPECIES
235674 Mus musculus

Protein level used designations for ACAA1B

  • 3-ketoacyl-CoA thiolase B, peroxisomal
  • acetyl-CoA acyltransferase B
  • beta-ketothiolase B
  • peroxisomal 3-oxoacyl-CoA thiolase B
  • thiolase B
Other products related to ACAA1B such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com