ACAA1B (Acetyl-Coenzyme A Acyltransferase 1B, ACAA1B)

Products related to ACAA1B Gene:
63 Products
Type
  • 59
  • 4
Species
  • 43
  • 20
Application
  • 40
  • 14
  • 12
  • 9
Fusion tag
  • 21
  • 8
  • 7
  • 4
  • 4
Vector Backbone
  • 4
  • 4
  • 3
  • 3
  • 2
Vector
  • 29
  • 17
  • 8
  • 3
  • 2
Insert
  • 22
  • 20
  • 8
  • 5
  • 4
Oligo-Type
  • 4
Resistance Gene
  • 32
  • 18
  • 8
  • 1
Expression Type
  • 45
  • 24
  • 13
Selectable Marker
  • 15
  • 13
  • 10
Promoter
  • 19
  • 16
  • 15
  • 8
  • 4
Format
  • 28
  • 17
  • 13
  • 5
Supplier: Log in to see

Full length Mus musculus acetyl-Coenzyme A acyltransferase 1B cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
Gene ID:
235674 (Mouse (Murine), ACAA1B)
Synonyms:
Acaa1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3837292
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Rattus norvegicus acetyl-Coenzyme A acyltransferase 1B cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
Gene ID:
501072 (Rat (Rattus), ACAA1B)
Synonyms:
Acaa1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4060944
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Clone DNA of Mus musculus acetyl-Coenzyme A acyltransferase 1B

Type:
cDNA
Application:
Cloning
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_146230
Species:
Mouse (Murine)
Synonyms:
Acaa1b
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545882
$125.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus acetyl-Coenzyme A acyltransferase 1B cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
Gene ID:
235674 (Mouse (Murine), ACAA1B)
Synonyms:
Acaa1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3837290
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Rattus norvegicus acetyl-Coenzyme A acyltransferase 1B cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
Gene ID:
501072 (Rat (Rattus), ACAA1B)
Synonyms:
Acaa1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4060943
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Rat Acaa1b is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_001040019,NP_001035108
Species:
Rat (Rattus)
Synonyms:
Acaa1b
Insert length:
1275 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308456
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Individual gRNA against RGD1562373 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_001040019
Species:
Rat (Rattus)
Synonyms:
Acaa1b
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of RGD1562373
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5181536
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Individual gRNA against Acaa1b in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_146230
Species:
Mouse (Murine)
Synonyms:
Acaa1b
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Acaa1b
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5181534
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

Application:
RNA Interference
Gene:
Acetyl-Coenzyme A Acyltransferase 1B
Species:
Rat (Rattus)
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • RGD1562373 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3315815
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

Application:
RNA Interference
Gene:
Acetyl-Coenzyme A Acyltransferase 1B
Species:
Mouse (Murine)
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Acaa1b (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3270128
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_146230
Species:
Mouse (Murine)
Synonyms:
Acaa1b
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5771602
$475.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

siRNA to inhibit ACAA1B expression using RNA interference.

Application:
RNA Interference
Gene:
Acetyl-Coenzyme A Acyltransferase 1B
Gene ID:
501072 (Rat (Rattus), ACAA1B)
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5805123
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

siRNA to inhibit ACAA1B expression using RNA interference.

Application:
RNA Interference
Gene:
Acetyl-Coenzyme A Acyltransferase 1B
Gene ID:
235674 (Mouse (Murine), ACAA1B)
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5805124
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

Individual gRNA against Acaa1b in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (sgRNA and Cas9 in a single vector)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_146230
Species:
Mouse (Murine)
Synonyms:
Acaa1b
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Acaa1b
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5297145
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Individual gRNA against RGD1562373 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (sgRNA and Cas9 in a single vector)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_001040019
Species:
Rat (Rattus)
Synonyms:
Acaa1b
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of RGD1562373
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5297147
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Mammalian expression of Rat RGD1562373 with His tag

Type:
cDNA
Application:
Protein Expression
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_001040019
Species:
Rat (Rattus)
Synonyms:
Acaa1b
Insert length:
1275 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4382341
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Mouse Acaa1b with His tag

Type:
cDNA
Application:
Protein Expression
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_146230
Species:
Mouse (Murine)
Synonyms:
Acaa1b
Insert length:
1275 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4403345
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Mouse Acaa1b with HA tag

Type:
cDNA
Application:
Protein Expression
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_146230
Species:
Mouse (Murine)
Synonyms:
Acaa1b
Insert length:
1275 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4492573
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Rat RGD1562373 with HA tag

Type:
cDNA
Application:
Protein Expression
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_001040019
Species:
Rat (Rattus)
Synonyms:
Acaa1b
Insert length:
1275 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4465891
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Mouse Acaa1b with His-GST

Type:
cDNA
Application:
Cloning
Gene:
Acetyl-Coenzyme A Acyltransferase 1B (ACAA1B)
NCBI Accession:
NM_146230
Species:
Mouse (Murine)
Synonyms:
Acaa1b
Insert length:
1669 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4845523
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ACAA1B

  • acetyl-Coenzyme A acyltransferase 1B (Acaa1b)

Gene-IDs for different species

GENE IDSPECIES
235674 Mus musculus

Protein level used designations for ACAA1B

  • 3-ketoacyl-CoA thiolase B, peroxisomal
  • acetyl-CoA acyltransferase B
  • beta-ketothiolase B
  • peroxisomal 3-oxoacyl-CoA thiolase B
  • thiolase B
Other products related to ACAA1B such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com