ACADVL (Acyl-CoA Dehydrogenase, Very Long Chain, ACADVL)

Short Description: The protein encoded by this gene is targeted to the inner mitochondrial membrane where it catalyzes the first step of the mitochondrial fatty acid beta-oxidation pathway. This acyl-Coenzyme A dehydrogenase is specific to long-chain and very-long-chain fatty acids. A deficiency in this gene product reduces myocardial fatty acid beta-oxidation and is associated with cardiomyopathy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008].
More information related to gene ACADVL.
Products related to ACADVL Gene:
Type
  • 144
  • 4
Species
  • 62
  • 41
  • 26
  • 14
  • 4
Application
  • 102
  • 28
  • 20
  • 16
  • 2
Fusion tag
  • 44
  • 17
  • 15
  • 14
  • 9
Vector Backbone
  • 8
  • 7
  • 7
  • 6
  • 6
Vector
  • 77
  • 37
  • 12
  • 9
  • 5
Insert
  • 68
  • 42
  • 18
  • 8
  • 6
Oligo-Type
  • 2
  • 2
Resistance Gene
  • 71
  • 47
  • 22
  • 4
  • 2
Expression Type
  • 99
  • 50
  • 39
Selectable Marker
  • 39
  • 27
  • 26
Promoter
  • 54
  • 37
  • 28
  • 14
  • 8
Format
  • 84
  • 27
  • 22
  • 15
148 Products

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acyl-CoA Dehydrogenase, Very Long Chain (ACADVL)
Gene ID:
573723 (Zebrafish (Danio rerio), ACADVL)
Synonyms:
ACADVL, Acadvl, acadvl
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3878416
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acyl-CoA Dehydrogenase, Very Long Chain (ACADVL)
Gene ID:
573723 (Zebrafish (Danio rerio), ACADVL)
Synonyms:
ACADVL, Acadvl, acadvl
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4066526
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acyl-CoA Dehydrogenase, Very Long Chain (ACADVL)
Gene ID:
573723 (Zebrafish (Danio rerio), ACADVL)
Synonyms:
ACADVL, Acadvl, acadvl
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3865411
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acyl-CoA Dehydrogenase, Very Long Chain (ACADVL)
Gene ID:
573723 (Zebrafish (Danio rerio), ACADVL)
Synonyms:
ACADVL, Acadvl, acadvl
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4066527
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Acyl-CoA Dehydrogenase, Very Long Chain (ACADVL)
NCBI Accession:
NM_017366
Species:
Mouse
Synonyms:
ACADVL, Acadvl, acadvl
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611391
$158.97
1 vial
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Acyl-CoA Dehydrogenase, Very Long Chain (ACADVL)
NCBI Accession:
NM_000018
Species:
Human
Synonyms:
ACADVL, Acadvl, acadvl
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611392
$158.97
1 vial
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Acyl-CoA Dehydrogenase, Very Long Chain (ACADVL)
Species:
Cynomolgus
Synonyms:
ACADVL, Acadvl, acadvl
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3561916
$158.97
1 vial
Plus shipping costs $45.00
Delivery in 17 to 23 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acyl-CoA Dehydrogenase, Very Long Chain (ACADVL)
Gene ID:
37 (Human, ACADVL)
Synonyms:
ACADVL, Acadvl, acadvl
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3803092
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Acyl-CoA Dehydrogenase, Very Long Chain (ACADVL)
Gene ID:
37 (Human, ACADVL)
Synonyms:
ACADVL, Acadvl, acadvl
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4082973
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Acyl-CoA Dehydrogenase, Very Long Chain (ACADVL)
Gene ID:
37 (Human, ACADVL)
Synonyms:
ACADVL, Acadvl, acadvl
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4082974
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acyl-CoA Dehydrogenase, Very Long Chain (ACADVL)
Gene ID:
11370 (Mouse, ACADVL)
Synonyms:
ACADVL, Acadvl, acadvl
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3807475
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acyl-CoA Dehydrogenase, Very Long Chain (ACADVL)
Gene ID:
25363 (Rat, ACADVL)
Synonyms:
ACADVL, Acadvl, acadvl
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045799
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acyl-CoA Dehydrogenase, Very Long Chain (ACADVL)
Gene ID:
282130 (Cow, ACADVL)
Synonyms:
ACADVL, Acadvl, acadvl
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3839441
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Application:
Quantitative real-time PCR
Gene:
Acyl-CoA Dehydrogenase, Very Long Chain
Species:
Mouse
Synonyms:
ACAD6, LCACD, VLCAD, vlcad, fb52d04, wu:fb52d04, wu:fc75e01, zgc:64067
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194897
$164.38
1 vial
Plus shipping costs $45.00
Delivery in 12 to 16 Business Days

Application:
Quantitative real-time PCR
Gene:
Acyl-CoA Dehydrogenase, Very Long Chain
Species:
Human
Synonyms:
ACAD6, LCACD, VLCAD, vlcad, fb52d04, wu:fb52d04, wu:fc75e01, zgc:64067
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189568
$164.38
1 vial
Plus shipping costs $45.00
Delivery in 12 to 16 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Acyl-CoA Dehydrogenase, Very Long Chain (ACADVL)
Gene ID:
37 (Human, ACADVL)
Synonyms:
ACADVL, Acadvl, acadvl
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3408529
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Acyl-CoA Dehydrogenase, Very Long Chain (ACADVL)
NCBI Accession:
NM_017366
Species:
Mouse
Synonyms:
ACADVL, Acadvl, acadvl
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Acadvl
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5130186
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Acyl-CoA Dehydrogenase, Very Long Chain (ACADVL)
NCBI Accession:
NM_000018
Species:
Human
Synonyms:
ACADVL, Acadvl, acadvl
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ACADVL
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5130184
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Acyl-CoA Dehydrogenase, Very Long Chain (ACADVL)
NCBI Accession:
NM_012891
Species:
Rat
Synonyms:
ACADVL, Acadvl, acadvl
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Acadvl
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5130188
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
Acyl-CoA Dehydrogenase, Very Long Chain (ACADVL)
NCBI Accession:
NM_001033859,NP_001029031
Species:
Human
Synonyms:
ACADVL, Acadvl, acadvl
Insert length:
1902 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5421223
$433.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
  • <
  • 1

Synonyms and alternative names related to ACADVL

  • acyl-CoA dehydrogenase very long chain (ACADVL)
  • acyl-Coenzyme A dehydrogenase, very long chain (Acadvl)
  • acyl-CoA dehydrogenase, very long chain (Acadvl)
  • acyl-CoA dehydrogenase very long chain (acadvl)
  • acyl-CoA dehydrogenase very long chain (Acadvl)
  • ACAD6
  • fb52d04
  • LCACD
  • VLCAD
  • vlcad
  • wu:fb52d04
  • wu:fc75e01
  • zgc:64067

Gene-IDs for different species

GENE IDSPECIES
37 Homo sapiens
11370 Mus musculus
25363 Rattus norvegicus
282130 Bos taurus
489463 Canis lupus familiaris
573723 Danio rerio
100061583 Equus caballus
100713909 Cavia porcellus
101925858

Protein level used designations for ACADVL

  • acyl-Coenzyme A dehydrogenase, very long chain
  • very long-chain specific acyl-CoA dehydrogenase, mitochondrial
  • MVLCAD
  • VLCAD very-long-chain acyl-CoA dehydrogenase
  • Very long chain Acyl-Coa dehydrogenase
  • VLCAD
  • acyl-coenzyme A dehydrogenase, very long chain
  • vlcad
  • Very long-chain specific acyl-CoA dehydrogenase, mitochondrial
  • Very-long-chain acyl-CoA dehydrogenase
Other products related to ACADVL such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com