ACAP1 (ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 1, ACAP1)

Short Description: GTPase-activating protein (GAP) for ADP ribosylation factor 6 (ARF6) required for clathrin-dependent export of proteins from recycling endosomes to trans-Golgi network and cell surface.
More information related to gene ACAP1.
Products related to ACAP1 Gene:
114 Products
  • 108
  • 6
  • 53
  • 31
  • 26
  • 2
  • 2
  • 5
  • 1
  • 38
  • 34
  • 20
  • 8
  • 6
  • 46
  • 35
  • 12
  • 9
  • 3
Vector Backbone
  • 8
  • 6
  • 6
  • 6
  • 6
Fusion tag
  • 41
  • 15
  • 11
  • 10
  • 8
Resistance Gene
  • 45
  • 41
  • 18
  • 4
  • 2
Selectable Marker
  • 26
  • 24
  • 13
  • 30
  • 30
  • 28
  • 13
  • 8
Expression Type
  • 92
  • 49
  • 13
  • 67
  • 27
  • 25
  • 16
  • 1
  • 50
  • 27
  • 22
  • 15
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 1 (ACAP1)
ACAP1, Acap1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5738977
1 μg
Plus shipping costs €45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens ArfGAP with coiled-coil, ankyrin repeat and PH domains 1.

ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 1 (ACAP1)
ACAP1, Acap1
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3545891
1 vial
Plus shipping costs €45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Verified forward and reverse primers for analyzing the quantitative expression of gene

Quantitative real-time PCR
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 1
CENTB1, Centb1
-20 °C
Catalog No. ABIN3191205
1 vial
Plus shipping costs €45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Full length Danio rerio ArfGAP with coiled-coil, ankyrin repeat and PH domains 1 cDNA clone.

Protein Expression, Cloning
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 1 (ACAP1)
Gene ID:
561771 (Zebrafish (Danio rerio), ACAP1)
ACAP1, Acap1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4066034
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus ArfGAP with coiled-coil, ankyrin repeat and PH domains 1 cDNA clone.

Protein Expression, Cloning
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 1 (ACAP1)
Gene ID:
216859 (Mouse (Murine), ACAP1)
ACAP1, Acap1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3834507
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus ArfGAP with coiled-coil, ankyrin repeat and PH domains 1 cDNA clone.

Protein Expression, Cloning
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 1 (ACAP1)
Gene ID:
216859 (Mouse (Murine), ACAP1)
ACAP1, Acap1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3834506
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Bos taurus ArfGAP with coiled-coil, ankyrin repeat and PH domains 1 cDNA clone.

Protein Expression, Cloning
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 1 (ACAP1)
Gene ID:
508582 (Cow (Bovine), ACAP1)
ACAP1, Acap1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3855963
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens ArfGAP with coiled-coil, ankyrin repeat and PH domains 1 cDNA clone.

Protein Expression, Cloning
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 1 (ACAP1)
Gene ID:
9744 (Human, ACAP1)
ACAP1, Acap1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3806660
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Danio rerio ArfGAP with coiled-coil, ankyrin repeat and PH domains 1 cDNA clone.

Protein Expression, Cloning
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 1 (ACAP1)
Gene ID:
561771 (Zebrafish (Danio rerio), ACAP1)
ACAP1, Acap1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4066033
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus ArfGAP with coiled-coil, ankyrin repeat and PH domains 1 cDNA clone.

Protein Expression, Cloning
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 1 (ACAP1)
Gene ID:
216859 (Mouse (Murine), ACAP1)
ACAP1, Acap1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3834509
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus ArfGAP with coiled-coil, ankyrin repeat and PH domains 1 cDNA clone.

Protein Expression, Cloning
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 1 (ACAP1)
Gene ID:
216859 (Mouse (Murine), ACAP1)
ACAP1, Acap1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3834508
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Bos taurus ArfGAP with coiled-coil, ankyrin repeat and PH domains 1 cDNA clone.

Protein Expression, Cloning
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 1 (ACAP1)
Gene ID:
508582 (Cow (Bovine), ACAP1)
ACAP1, Acap1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3855964
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens ArfGAP with coiled-coil, ankyrin repeat and PH domains 1 cDNA clone.

Protein Expression, Cloning
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 1 (ACAP1)
Gene ID:
9744 (Human, ACAP1)
ACAP1, Acap1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3806659
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ACAP1 is ideal for over-expression of native protein for functional studies.

Protein Expression
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 1 (ACAP1)
NCBI Accession:
ACAP1, Acap1
Insert length:
2190 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3376880
10 μg
Plus shipping costs €45.00
Delivery in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ACAP1 is ideal for over-expression of native protein for functional studies.

Protein Expression
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 1 (ACAP1)
NCBI Accession:
ACAP1, Acap1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Transient, Stable

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3318607
10 μg
Plus shipping costs €45.00
Delivery in 8 to 11 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 1 (ACAP1)
Gene ID:
9744 (Human, ACAP1)
ACAP1, Acap1
Insert length:
2223 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5312749
2 μg
Plus shipping costs €45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Mammalian expression of Human ACAP1 with HA tag

Protein Expression
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 1 (ACAP1)
ACAP1, Acap1
Insert length:
2223 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4471694
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ACAP1 with His-MBP

ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 1 (ACAP1)
ACAP1, Acap1
Insert length:
2223 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4696855
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ACAP1 with His tag

ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 1 (ACAP1)
ACAP1, Acap1
Insert length:
2223 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4758069
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ACAP1 with His-GST

ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 1 (ACAP1)
ACAP1, Acap1
Insert length:
2223 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4825984
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ACAP1

  • ArfGAP with coiled-coil, ankyrin repeat and PH domains 1 (ACAP1)
  • ArfGAP with coiled-coil, ankyrin repeat and PH domains 1 (Acap1)
  • CENTB1
  • Centb1

Gene-IDs for different species

455275 Pan troglodytes
721824 Macaca mulatta
100016342 Monodelphis domestica
100072970 Equus caballus
100359236 Oryctolagus cuniculus
100481518 Ailuropoda melanoleuca
100607184 Nomascus leucogenys
100623422 Sus scrofa
508582 Bos taurus
9744 Homo sapiens
216859 Mus musculus
287443 Rattus norvegicus

Protein level used designations for ACAP1

  • centaurin beta1
  • centaurin, beta 1
  • ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
  • arf-GAP with coiled-coil, ANK repeat and PH domain-containing protein 1-like
  • arf-GAP with coiled-coil, ANK repeat and PH domain-containing protein 1
  • centaurin-beta-1
  • cnt-b1
  • Arf GAP with coiled coil, ANK repeat and PH domains 1
Other products related to ACAP1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website