ACBD7 (Acyl-CoA Binding Domain Containing 7, ACBD7)

Short Description: Binds medium- and long-chain acyl-CoA esters (By similarity).
More information related to gene ACBD7.
Products related to ACBD7 Gene:
97 Products
Type
  • 92
  • 5
Species
  • 39
  • 28
  • 22
  • 2
  • 2
Oligo-Type
  • 5
Insert
  • 37
  • 23
  • 20
  • 6
  • 4
Vector
  • 32
  • 29
  • 12
  • 9
  • 7
Vector Backbone
  • 6
  • 6
  • 6
  • 4
  • 4
Fusion tag
  • 35
  • 15
  • 10
  • 9
  • 8
Resistance Gene
  • 33
  • 33
  • 20
  • 6
  • 2
Selectable Marker
  • 24
  • 23
  • 1
Promoter
  • 30
  • 26
  • 12
  • 10
  • 6
Expression Type
  • 85
  • 46
Application
  • 48
  • 26
  • 25
  • 12
Format
  • 35
  • 27
  • 18
  • 17
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
Acyl-CoA Binding Domain Containing 7 (ACBD7)
Species:
Human
Synonyms:
ACBD7, acbd7, acbd7.L, Acbd7
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5748216
$45.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human acyl-CoA binding domain containing 7 (ACBD7)

Type:
ORF
Application:
Protein Expression
Gene:
Acyl-CoA Binding Domain Containing 7 (ACBD7)
NCBI Accession:
NM_001039844,NP_001034933
Species:
Human
Synonyms:
ACBD7, acbd7, acbd7.L, Acbd7
Insert length:
267 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5426686
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Full length Xenopus laevis acyl-CoA binding domain containing 7 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Acyl-CoA Binding Domain Containing 7 (ACBD7)
Gene ID:
734680 (Xenopus laevis, ACBD7)
Synonyms:
ACBD7, acbd7, acbd7.L, Acbd7
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3484703
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens acyl-CoA binding domain containing 7 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Acyl-CoA Binding Domain Containing 7 (ACBD7)
Gene ID:
414149 (Human, ACBD7)
Synonyms:
ACBD7, acbd7, acbd7.L, Acbd7
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3470721
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Bos taurus acyl-CoA binding domain containing 7 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acyl-CoA Binding Domain Containing 7 (ACBD7)
Gene ID:
508284 (Cow (Bovine), ACBD7)
Synonyms:
ACBD7, acbd7, acbd7.L, Acbd7
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3855807
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus tropicalis acyl-CoA binding domain containing 7 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acyl-CoA Binding Domain Containing 7 (ACBD7)
Gene ID:
779685 (Xenopus tropicalis, ACBD7)
Synonyms:
ACBD7, acbd7, acbd7.L, Acbd7
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3869821
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens acyl-CoA binding domain containing 7 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Acyl-CoA Binding Domain Containing 7 (ACBD7)
Gene ID:
414149 (Human, ACBD7)
Synonyms:
ACBD7, acbd7, acbd7.L, Acbd7
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3470720
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus laevis acyl-CoA binding domain containing 7 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Acyl-CoA Binding Domain Containing 7 (ACBD7)
Gene ID:
734680 (Xenopus laevis, ACBD7)
Synonyms:
ACBD7, acbd7, acbd7.L, Acbd7
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4044386
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Bos taurus acyl-CoA binding domain containing 7 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acyl-CoA Binding Domain Containing 7 (ACBD7)
Gene ID:
508284 (Cow (Bovine), ACBD7)
Synonyms:
ACBD7, acbd7, acbd7.L, Acbd7
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3855809
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus tropicalis acyl-CoA binding domain containing 7 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acyl-CoA Binding Domain Containing 7 (ACBD7)
Gene ID:
779685 (Xenopus tropicalis, ACBD7)
Synonyms:
ACBD7, acbd7, acbd7.L, Acbd7
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3869822
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

Type:
ORF
Application:
Cloning
Gene:
Acyl-CoA Binding Domain Containing 7 (ACBD7)
Gene ID:
414149 (Human, ACBD7)
Synonyms:
ACBD7, acbd7, acbd7.L, Acbd7
Insert length:
267 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5315118
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Mammalian expression of Human ACBD7 with HA tag

Type:
cDNA
Application:
Protein Expression
Gene:
Acyl-CoA Binding Domain Containing 7 (ACBD7)
Species:
Human
Synonyms:
ACBD7, acbd7, acbd7.L, Acbd7
Insert length:
267 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4471700
$275.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ACBD7 with His-MBP

Type:
cDNA
Application:
Cloning
Gene:
Acyl-CoA Binding Domain Containing 7 (ACBD7)
Species:
Human
Synonyms:
ACBD7, acbd7, acbd7.L, Acbd7
Insert length:
267 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4696864
$275.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ACBD7 with His tag

Type:
cDNA
Application:
Cloning
Gene:
Acyl-CoA Binding Domain Containing 7 (ACBD7)
Species:
Human
Synonyms:
ACBD7, acbd7, acbd7.L, Acbd7
Insert length:
267 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4758075
$275.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ACBD7 with His-GST

Type:
cDNA
Application:
Cloning
Gene:
Acyl-CoA Binding Domain Containing 7 (ACBD7)
Species:
Human
Synonyms:
ACBD7, acbd7, acbd7.L, Acbd7
Insert length:
267 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4825993
$275.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ACBD7 with His tag

Type:
cDNA
Application:
Cloning
Gene:
Acyl-CoA Binding Domain Containing 7 (ACBD7)
Species:
Human
Synonyms:
ACBD7, acbd7, acbd7.L, Acbd7
Insert length:
267 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4372167
$275.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Human ACBD7 with His tag

Type:
cDNA
Application:
Protein Expression
Gene:
Acyl-CoA Binding Domain Containing 7 (ACBD7)
Species:
Human
Synonyms:
ACBD7, acbd7, acbd7.L, Acbd7
Insert length:
267 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4432795
$275.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

The acyl-CoA binding domain containing 7 ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Type:
ORF
Application:
Protein Expression
Gene:
Acyl-CoA Binding Domain Containing 7 (ACBD7)
Gene ID:
414149 (Human, ACBD7)
Synonyms:
ACBD7, acbd7, acbd7.L, Acbd7
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3396775
$300.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

The acyl-CoA binding domain containing 7 ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Type:
ORF
Application:
Protein Expression
Gene:
Acyl-CoA Binding Domain Containing 7 (ACBD7)
Gene ID:
414149 (Human, ACBD7)
Synonyms:
ACBD7, acbd7, acbd7.L, Acbd7
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3430135
$300.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

Application:
RNA Interference
Gene:
Acyl-CoA Binding Domain Containing 7
Species:
Human
Synonyms:
zgc:114176, bA455B2.2, RGD1564164, 9230116B18Rik
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • ACBD7 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3273306
$390.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to ACBD7

  • acyl-CoA binding domain containing 7 (ACBD7)
  • acyl-CoA binding domain containing 7 (acbd7)
  • acyl-CoA binding domain containing 7 L homeolog (acbd7.L)
  • acyl-CoA binding domain containing 7 (Acbd7)
  • acyl-Coenzyme A binding domain containing 7 (Acbd7)
  • 9230116B18Rik
  • bA455B2.2
  • RGD1564164
  • zgc:114176

Gene-IDs for different species

GENE IDSPECIES
420531 Gallus gallus
607198 Canis lupus familiaris
619256 Danio rerio
734680 Xenopus laevis
739212 Pan troglodytes
779685 Xenopus (Silurana) tropicalis
100196088 Salmo salar
414149 Homo sapiens
508284 Bos taurus
361277 Rattus norvegicus
78245 Mus musculus

Protein level used designations for ACBD7

  • acyl-Coenzyme A binding domain containing 7
  • acyl-CoA binding domain containing 7
  • acyl-CoA-binding domain-containing protein 7
Other products related to ACBD7 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com