ACBD7 (Acyl-CoA Binding Domain Containing 7, ACBD7)

Short Description: Binds medium- and long-chain acyl-CoA esters (By similarity).
More information related to gene ACBD7.
Products related to ACBD7 Gene:
97 Products
  • 92
  • 5
  • 39
  • 28
  • 22
  • 2
  • 2
  • 48
  • 26
  • 25
  • 12
Fusion tag
  • 35
  • 15
  • 10
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 4
  • 4
  • 32
  • 29
  • 12
  • 9
  • 7
  • 37
  • 23
  • 20
  • 6
  • 4
  • 5
Resistance Gene
  • 33
  • 33
  • 20
  • 6
  • 2
Expression Type
  • 85
  • 46
Selectable Marker
  • 24
  • 23
  • 1
  • 30
  • 26
  • 12
  • 10
  • 6
  • 35
  • 27
  • 18
  • 17
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Acyl-CoA Binding Domain Containing 7 (ACBD7)
ACBD7, acbd7, acbd7.L, Acbd7
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5748216
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human acyl-CoA binding domain containing 7 (ACBD7)

Protein Expression
Acyl-CoA Binding Domain Containing 7 (ACBD7)
NCBI Accession:
ACBD7, acbd7, acbd7.L, Acbd7
Insert length:
267 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5426686
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Full length Bos taurus acyl-CoA binding domain containing 7 cDNA clone.

Protein Expression, Cloning
Acyl-CoA Binding Domain Containing 7 (ACBD7)
Gene ID:
508284 (Cow (Bovine), ACBD7)
ACBD7, acbd7, acbd7.L, Acbd7
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3855807
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus tropicalis acyl-CoA binding domain containing 7 cDNA clone.

Protein Expression, Cloning
Acyl-CoA Binding Domain Containing 7 (ACBD7)
Gene ID:
779685 (Xenopus tropicalis, ACBD7)
ACBD7, acbd7, acbd7.L, Acbd7
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3869821
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens acyl-CoA binding domain containing 7 cDNA clone.

Acyl-CoA Binding Domain Containing 7 (ACBD7)
Gene ID:
414149 (Human, ACBD7)
ACBD7, acbd7, acbd7.L, Acbd7
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3470721
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus laevis acyl-CoA binding domain containing 7 cDNA clone.

Acyl-CoA Binding Domain Containing 7 (ACBD7)
Gene ID:
734680 (Xenopus laevis, ACBD7)
ACBD7, acbd7, acbd7.L, Acbd7
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN3484703
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus laevis acyl-CoA binding domain containing 7 cDNA clone.

Acyl-CoA Binding Domain Containing 7 (ACBD7)
Gene ID:
734680 (Xenopus laevis, ACBD7)
ACBD7, acbd7, acbd7.L, Acbd7
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4044386
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Bos taurus acyl-CoA binding domain containing 7 cDNA clone.

Protein Expression, Cloning
Acyl-CoA Binding Domain Containing 7 (ACBD7)
Gene ID:
508284 (Cow (Bovine), ACBD7)
ACBD7, acbd7, acbd7.L, Acbd7
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3855809
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus tropicalis acyl-CoA binding domain containing 7 cDNA clone.

Protein Expression, Cloning
Acyl-CoA Binding Domain Containing 7 (ACBD7)
Gene ID:
779685 (Xenopus tropicalis, ACBD7)
ACBD7, acbd7, acbd7.L, Acbd7
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3869822
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens acyl-CoA binding domain containing 7 cDNA clone.

Acyl-CoA Binding Domain Containing 7 (ACBD7)
Gene ID:
414149 (Human, ACBD7)
ACBD7, acbd7, acbd7.L, Acbd7
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3470720
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

Acyl-CoA Binding Domain Containing 7 (ACBD7)
Gene ID:
414149 (Human, ACBD7)
ACBD7, acbd7, acbd7.L, Acbd7
Insert length:
267 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5315118
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Bacterial expression of Human ACBD7 with His tag

Acyl-CoA Binding Domain Containing 7 (ACBD7)
ACBD7, acbd7, acbd7.L, Acbd7
Insert length:
267 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4372167
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Human ACBD7 with His tag

Protein Expression
Acyl-CoA Binding Domain Containing 7 (ACBD7)
ACBD7, acbd7, acbd7.L, Acbd7
Insert length:
267 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4432795
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Human ACBD7 with HA tag

Protein Expression
Acyl-CoA Binding Domain Containing 7 (ACBD7)
ACBD7, acbd7, acbd7.L, Acbd7
Insert length:
267 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4471700
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ACBD7 with His-GST

Acyl-CoA Binding Domain Containing 7 (ACBD7)
ACBD7, acbd7, acbd7.L, Acbd7
Insert length:
267 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4825993
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ACBD7 with His tag

Acyl-CoA Binding Domain Containing 7 (ACBD7)
ACBD7, acbd7, acbd7.L, Acbd7
Insert length:
267 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4758075
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ACBD7 with His-MBP

Acyl-CoA Binding Domain Containing 7 (ACBD7)
ACBD7, acbd7, acbd7.L, Acbd7
Insert length:
267 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4696864
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

The acyl-CoA binding domain containing 7 ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Protein Expression
Acyl-CoA Binding Domain Containing 7 (ACBD7)
Gene ID:
414149 (Human, ACBD7)
ACBD7, acbd7, acbd7.L, Acbd7
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3396775
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

The acyl-CoA binding domain containing 7 ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Protein Expression
Acyl-CoA Binding Domain Containing 7 (ACBD7)
Gene ID:
414149 (Human, ACBD7)
ACBD7, acbd7, acbd7.L, Acbd7
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3430135
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Acbd7 is ideal for over-expression of native protein for functional studies.

Protein Expression
Acyl-CoA Binding Domain Containing 7 (ACBD7)
NCBI Accession:
Mouse (Murine)
ACBD7, acbd7, acbd7.L, Acbd7
Insert length:
267 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3308501
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to ACBD7

  • acyl-CoA binding domain containing 7 (ACBD7)
  • acyl-CoA binding domain containing 7 (acbd7)
  • acyl-CoA binding domain containing 7 L homeolog (acbd7.L)
  • acyl-CoA binding domain containing 7 (Acbd7)
  • acyl-Coenzyme A binding domain containing 7 (Acbd7)
  • 9230116B18Rik
  • bA455B2.2
  • RGD1564164
  • zgc:114176

Gene-IDs for different species

420531 Gallus gallus
607198 Canis lupus familiaris
619256 Danio rerio
734680 Xenopus laevis
739212 Pan troglodytes
779685 Xenopus (Silurana) tropicalis
100196088 Salmo salar
414149 Homo sapiens
508284 Bos taurus
361277 Rattus norvegicus
78245 Mus musculus

Protein level used designations for ACBD7

  • acyl-Coenzyme A binding domain containing 7
  • acyl-CoA binding domain containing 7
  • acyl-CoA-binding domain-containing protein 7
Other products related to ACBD7 such as antibodies, ELISA kits and high-purity proteins are available on our partner website