ACCSL (1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like, ACCSL)

Products related to ACCSL Gene:
76 Products
  • 72
  • 4
  • 30
  • 24
  • 22
  • 36
  • 24
  • 16
  • 12
Fusion tag
  • 26
  • 14
  • 8
  • 8
  • 6
Vector Backbone
  • 6
  • 6
  • 6
  • 5
  • 5
  • 33
  • 18
  • 9
  • 8
  • 4
  • 21
  • 20
  • 15
  • 8
  • 6
  • 4
Resistance Gene
  • 29
  • 25
  • 16
  • 2
  • 2
Expression Type
  • 70
  • 44
Selectable Marker
  • 26
  • 23
  • 30
  • 23
  • 8
  • 8
  • 6
  • 30
  • 22
  • 18
  • 6
Supplier: Log in to see

Full length Mus musculus 1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like cDNA clone.

1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
Gene ID:
381411 (Mouse (Murine), ACCSL)
Accsl, ACCSL
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4018344
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus 1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like cDNA clone.

1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
Gene ID:
381411 (Mouse (Murine), ACCSL)
Accsl, ACCSL
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4018343
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human 1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like (ACCSL)

Protein Expression
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
Accsl, ACCSL
Insert length:
1707 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5424331
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Individual gRNA against Accsl in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Genome Editing with Engineered Nucleases, Protein Expression
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
Mouse (Murine)
Accsl, ACCSL
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Accsl
Viral Particles
-80 °C
Catalog No. ABIN5132008
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

Individual gRNA against Accsl in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Genome Editing with Engineered Nucleases, Protein Expression
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
Rat (Rattus)
Accsl, ACCSL
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Accsl
Viral Particles
-80 °C
Catalog No. ABIN5132010
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

Individual gRNA against ACCSL in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Genome Editing with Engineered Nucleases, Protein Expression
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
Accsl, ACCSL
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ACCSL
Viral Particles
-80 °C
Catalog No. ABIN5132006
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

RNA Interference
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like
HPLC purified
Available with shipment
  • ACCSL (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3315131
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

RNA Interference
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like
Mouse (Murine)
HPLC purified
Available with shipment
  • Accsl (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3265250
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
Mouse (Murine)
Accsl, ACCSL
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5747486
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
Rat (Rattus)
Accsl, ACCSL
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5747487
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

siRNA to inhibit ACCSL expression using RNA interference.

RNA Interference
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like
Gene ID:
381411 (Mouse (Murine), ACCSL)
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
-20 °C
Catalog No. ABIN5794602
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

siRNA to inhibit ACCSL expression using RNA interference.

RNA Interference
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like
Gene ID:
390110 (Human, ACCSL)
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
-20 °C
Catalog No. ABIN5794603
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - with 3 vectors containing two gRNAs in each vector plus a negative control (glycerol stock)

Genome Editing with Engineered Nucleases
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
Gene ID:
390110 (Human, ACCSL)
Accsl, ACCSL
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
SFFV Promoter, U6 Promoter
Fusion Tag:
Transient, Stable

Viral particles:

- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Glycerol Stock
-80 °C
Catalog No. ABIN5036651
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Individual gRNA against ACCSL in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (sgRNA and Cas9 in a single vector)

gRNA + Cas9
Genome Editing with Engineered Nucleases, Protein Expression
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
Accsl, ACCSL
Vector type:
Lentiviral Vector
Resistance Gene:
Selection Marker:
U6 Promoter, SFFV Promoter
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ACCSL
Viral Particles
-80 °C
Catalog No. ABIN5247465
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

Individual gRNA against Accsl in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (sgRNA and Cas9 in a single vector)

gRNA + Cas9
Genome Editing with Engineered Nucleases, Protein Expression
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
Mouse (Murine)
Accsl, ACCSL
Vector type:
Lentiviral Vector
Resistance Gene:
Selection Marker:
U6 Promoter, SFFV Promoter
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Accsl
Viral Particles
-80 °C
Catalog No. ABIN5247467
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

Individual gRNA against Accsl in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (sgRNA and Cas9 in a single vector)

gRNA + Cas9
Genome Editing with Engineered Nucleases, Protein Expression
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
Rat (Rattus)
Accsl, ACCSL
Vector type:
Lentiviral Vector
Resistance Gene:
Selection Marker:
U6 Promoter, SFFV Promoter
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Accsl
Viral Particles
-80 °C
Catalog No. ABIN5247469
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

Mammalian expression of Mouse ACCSL with His tag

Protein Expression
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
Mouse (Murine)
Accsl, ACCSL
Insert length:
1743 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4403383
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Mouse ACCSL with HA tag

Protein Expression
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
Mouse (Murine)
Accsl, ACCSL
Insert length:
1743 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4492611
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Rat ACCSL with His tag

Protein Expression
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
Rat (Rattus)
Accsl, ACCSL
Insert length:
1854 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4497690
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Rat ACCSL with HA tag

Protein Expression
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
Rat (Rattus)
Accsl, ACCSL
Insert length:
1854 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4432448
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ACCSL

  • 1-aminocyclopropane-1-carboxylate synthase-like (Accsl)
  • 1-aminocyclopropane-1-carboxylate synthase (non-functional)-like (Accsl)
  • 1-aminocyclopropane-1-carboxylate synthase homolog (inactive) like (ACCSL)
  • Gm1967

Gene-IDs for different species

690470 Rattus norvegicus
381411 Mus musculus
390110 Homo sapiens
101116173 Ovis aries

Protein level used designations for ACCSL

  • 1-aminocyclopropane-1-carboxylate synthase-like protein 2
  • 1-aminocyclopropane-1-carboxylate synthase homolog(non-functional)-like
  • ACC synthase-like protein 2
  • novel aminotransferase class I and II domain containing protein
  • probable inactive 1-aminocyclopropane-1-carboxylate synthase-like protein 2
  • 1-aminocyclopropane-1-carboxylate synthase-like protein 2-like
Other products related to ACCSL such as antibodies, ELISA kits and high-purity proteins are available on our partner website