ACCSL (1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like, ACCSL)

Products related to ACCSL Gene:
Type
  • 69
  • 2
Species
  • 27
  • 22
  • 22
Application
  • 36
  • 20
  • 16
  • 11
Fusion tag
  • 23
  • 12
  • 8
  • 8
  • 6
Vector Backbone
  • 6
  • 6
  • 6
  • 5
  • 5
Vector
  • 33
  • 16
  • 9
  • 8
  • 3
Insert
  • 20
  • 18
  • 15
  • 8
  • 6
Oligo-Type
  • 2
Resistance Gene
  • 28
  • 23
  • 16
  • 2
  • 2
Expression Type
  • 68
  • 42
Selectable Marker
  • 26
  • 20
Promoter
  • 28
  • 21
  • 8
  • 8
  • 6
Format
  • 26
  • 22
  • 18
  • 5
71 Products

Type:
cDNA
Application:
Cloning
Gene:
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
Gene ID:
381411 (Mouse, ACCSL)
Synonyms:
Accsl, ACCSL
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4018343
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
NM_001033452
Species:
Mouse
Synonyms:
Accsl, ACCSL
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Accsl
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5132008
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
NM_001109594
Species:
Rat
Synonyms:
Accsl, ACCSL
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Accsl
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5132010
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
NM_001031854
Species:
Human
Synonyms:
Accsl, ACCSL
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ACCSL
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5132006
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Application:
RNA Interference
Gene:
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like
Species:
Mouse
Synonyms:
Gm1967
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Accsl (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3265250
$440.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like
Species:
Human
Synonyms:
Gm1967
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • ACCSL (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3315131
$440.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
Gene ID:
390110 (Human, ACCSL)
Synonyms:
Accsl, ACCSL
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5055596

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5036651
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
NM_001031854
Species:
Human
Synonyms:
Accsl, ACCSL
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ACCSL
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5247465
$520.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
NM_001033452
Species:
Mouse
Synonyms:
Accsl, ACCSL
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Accsl
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5247467
$520.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
NM_001109594
Species:
Rat
Synonyms:
Accsl, ACCSL
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Accsl
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5247469
$520.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
NM_001031854,NP_001027025
Species:
Human
Synonyms:
Accsl, ACCSL
Insert length:
1707 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5424331
$546.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Cloning
Gene:
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
NM_001109594
Species:
Rat
Synonyms:
Accsl, ACCSL
Insert length:
2167 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4680075
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
NM_001109594
Species:
Rat
Synonyms:
Accsl, ACCSL
Insert length:
2167 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4741332
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
NM_001109594
Species:
Rat
Synonyms:
Accsl, ACCSL
Insert length:
2167 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4542536
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
NM_001109594
Species:
Rat
Synonyms:
Accsl, ACCSL
Insert length:
2167 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4603727
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
NM_001033452
Species:
Mouse
Synonyms:
Accsl, ACCSL
Insert length:
2168 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4716430
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
NM_001033452
Species:
Mouse
Synonyms:
Accsl, ACCSL
Insert length:
2168 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4845561
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
NM_001033452
Species:
Mouse
Synonyms:
Accsl, ACCSL
Insert length:
2168 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4517675
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
NM_001033452
Species:
Mouse
Synonyms:
Accsl, ACCSL
Insert length:
2168 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4578882
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(non-Functional)-Like (ACCSL)
NCBI Accession:
NM_001109594
Species:
Rat
Synonyms:
Accsl, ACCSL
Insert length:
1854 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4432448
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ACCSL

  • 1-aminocyclopropane-1-carboxylate synthase-like (Accsl)
  • 1-aminocyclopropane-1-carboxylate synthase (non-functional)-like (Accsl)
  • 1-aminocyclopropane-1-carboxylate synthase homolog (inactive) like (ACCSL)
  • Gm1967

Gene-IDs for different species

GENE IDSPECIES
690470 Rattus norvegicus
381411 Mus musculus
390110 Homo sapiens
101116173 Ovis aries

Protein level used designations for ACCSL

  • 1-aminocyclopropane-1-carboxylate synthase-like protein 2
  • 1-aminocyclopropane-1-carboxylate synthase homolog(non-functional)-like
  • ACC synthase-like protein 2
  • novel aminotransferase class I and II domain containing protein
  • probable inactive 1-aminocyclopropane-1-carboxylate synthase-like protein 2
  • 1-aminocyclopropane-1-carboxylate synthase-like protein 2-like
Other products related to ACCSL such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com