ACE2 (Angiotensin I Converting Enzyme 2, ACE2)

Short Description: The protein encoded by this gene belongs to the angiotensin-converting enzyme family of dipeptidyl carboxydipeptidases and has considerable homology to human angiotensin 1 converting enzyme. This secreted protein catalyzes the cleavage of angiotensin I into angiotensin 1-9, and angiotensin II into the vasodilator angiotensin 1-7. The organ- and cell-specific expression of this gene suggests that it may play a role in the regulation of cardiovascular and renal function, as well as fertility. In addition, the encoded protein is a functional receptor for the spike glycoprotein of the human coronaviruses SARS and HCoV-NL63. [provided by RefSeq, Jul 2008].
More information related to gene ACE2.
Products related to ACE2 Gene:
Data Quality
  • 1
  • 3
Type
  • 149
  • 6
Species
  • 54
  • 47
  • 39
  • 12
  • 2
Application
  • 101
  • 31
  • 21
  • 16
  • 3
Fusion tag
  • 44
  • 20
  • 15
  • 12
  • 12
Vector Backbone
  • 8
  • 8
  • 6
  • 6
  • 6
Vector
  • 75
  • 39
  • 16
  • 9
  • 5
Insert
  • 69
  • 46
  • 18
  • 8
  • 6
Oligo-Type
  • 3
  • 3
Resistance Gene
  • 80
  • 42
  • 22
  • 5
  • 2
Expression Type
  • 99
  • 50
  • 44
Selectable Marker
  • 44
  • 27
  • 26
Promoter
  • 55
  • 36
  • 28
  • 17
  • 8
Format
  • 85
  • 36
  • 24
  • 10
155 Products

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Angiotensin I Converting Enzyme (Peptidyl-Dipeptidase A) 2 (ACE2)
Gene ID:
492331 (Zebrafish (Danio rerio), ACE2)
Synonyms:
ACE2, Ace2, ace2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4059064
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Angiotensin I Converting Enzyme (Peptidyl-Dipeptidase A) 2 (ACE2)
Gene ID:
492331 (Zebrafish (Danio rerio), ACE2)
Synonyms:
ACE2, Ace2, ace2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4059063
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Angiotensin I Converting Enzyme 2 (ACE2)
NCBI Accession:
NM_001135696
Species:
Rhesus Monkey
Synonyms:
ACE2, Ace2, ace2
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611650
$158.97
1 vial
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Angiotensin I Converting Enzyme 2 (ACE2)
NCBI Accession:
NM_021804
Species:
Human
Synonyms:
ACE2, Ace2, ace2
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611651
$158.97
1 vial
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Angiotensin I Converting Enzyme 2 (ACE2)
NCBI Accession:
NM_027286
Species:
Mouse
Synonyms:
ACE2, Ace2, ace2
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611652
$158.97
1 vial
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Angiotensin I Converting Enzyme 2 (ACE2)
NCBI Accession:
NM_001012006
Species:
Rat
Synonyms:
ACE2, Ace2, ace2
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611653
$158.97
1 vial
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Angiotensin I Converting Enzyme (Peptidyl-Dipeptidase A) 2 (ACE2)
Gene ID:
70008 (Mouse, ACE2)
Synonyms:
ACE2, Ace2, ace2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3823413
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Angiotensin I Converting Enzyme (Peptidyl-Dipeptidase A) 2 (ACE2)
Gene ID:
59272 (Human, ACE2)
Synonyms:
ACE2, Ace2, ace2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3818704
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Angiotensin I Converting Enzyme (Peptidyl-Dipeptidase A) 2 (ACE2)
Gene ID:
59272 (Human, ACE2)
Synonyms:
ACE2, Ace2, ace2
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4213090
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Angiotensin I Converting Enzyme (Peptidyl-Dipeptidase A) 2 (ACE2)
Gene ID:
509235 (Cow, ACE2)
Synonyms:
ACE2, Ace2, ace2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3856297
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Application:
Quantitative real-time PCR
Gene:
Angiotensin I Converting Enzyme 2
Species:
Human
Synonyms:
ACEH, 2010305L05Rik, zgc:92514
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188520
$164.38
1 vial
Plus shipping costs $45.00
Delivery in 12 to 16 Business Days

Application:
Quantitative real-time PCR
Gene:
Angiotensin I Converting Enzyme 2
Species:
Rat
Synonyms:
ACEH, 2010305L05Rik, zgc:92514
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196195
$164.38
1 vial
Plus shipping costs $45.00
Delivery in 12 to 16 Business Days

Application:
Quantitative real-time PCR
Gene:
Angiotensin I Converting Enzyme 2
Species:
Mouse
Synonyms:
ACEH, 2010305L05Rik, zgc:92514
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193831
$164.38
1 vial
Plus shipping costs $45.00
Delivery in 12 to 16 Business Days

Type:
ORF
Application:
Cloning
Gene:
Angiotensin I Converting Enzyme 2 (ACE2)
Gene ID:
59272 (Human, ACE2)
Synonyms:
ACE2, Ace2, ace2
Insert length:
2418 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5324216
$227.96
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Angiotensin I Converting Enzyme 2 (ACE2)
NCBI Accession:
NM_021804
Species:
Human
Synonyms:
ACE2, Ace2, ace2
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ACE2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5130206
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Angiotensin I Converting Enzyme 2 (ACE2)
NCBI Accession:
NM_001012006
Species:
Rat
Synonyms:
ACE2, Ace2, ace2
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Ace2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5130210
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Angiotensin I Converting Enzyme 2 (ACE2)
NCBI Accession:
NM_027286
Species:
Mouse
Synonyms:
ACE2, Ace2, ace2
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Ace2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5130208
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
Angiotensin I Converting Enzyme (Peptidyl-Dipeptidase A) 2 (ACE2)
NCBI Accession:
NM_021804,NP_068576
Species:
Human
Synonyms:
ACE2, Ace2, ace2
Insert length:
2418 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5421259
$433.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Application:
RNA Interference
Gene:
Angiotensin I Converting Enzyme 2
Species:
Mouse
Synonyms:
ACEH, 2010305L05Rik, zgc:92514
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Ace2 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3347182
$440.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Angiotensin I Converting Enzyme 2
Species:
Human
Synonyms:
ACEH, 2010305L05Rik, zgc:92514
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • ACE2 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3287821
$440.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to ACE2

  • angiotensin I converting enzyme 2 (ACE2)
  • angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 (Ace2)
  • angiotensin I converting enzyme 2 (Ace2)
  • angiotensin I converting enzyme 2 (ace2)
  • angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 (ACE2)
  • 2010305L05Rik
  • ACEH
  • zgc:92514

Gene-IDs for different species

GENE IDSPECIES
59272 Homo sapiens
70008 Mus musculus
302668 Rattus norvegicus
418623 Gallus gallus
480847 Canis lupus familiaris
509235 Bos taurus
554349 Felis catus
100171441 Pongo abelii
492331 Danio rerio
712790 Macaca mulatta
100144303 Sus scrofa
100302675 Cavia porcellus
100327258 Oryctolagus cuniculus

Protein level used designations for ACE2

  • ACE-related carboxypeptidase
  • angiotensin I converting enzyme (peptidyl-dipeptidase A) 2
  • angiotensin-converting enzyme 2
  • angiotensin-converting enzyme homolog
  • metalloprotease MPROT15
  • peptidyl-dipeptidase A
  • angiotensin I converting enzyme 2
  • anigotensin-converting enzyme-related carboxypeptidase
  • renal angiotensin-converting enzyme 2
Other products related to ACE2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com