AGXT2L1 (Alanine-Glyoxylate Aminotransferase 2-Like 1, AGXT2L1)

Products related to AGXT2L1 Gene:
126 Products
Type
  • 121
  • 5
Species
  • 55
  • 50
  • 14
  • 2
  • 2
Application
  • 88
  • 28
  • 16
  • 12
  • 1
Fusion tag
  • 38
  • 17
  • 13
  • 13
  • 7
Vector Backbone
  • 8
  • 8
  • 6
  • 5
  • 4
Vector
  • 66
  • 31
  • 12
  • 6
  • 2
Insert
  • 54
  • 43
  • 12
  • 6
  • 4
Oligo-Type
  • 4
  • 1
Resistance Gene
  • 57
  • 42
  • 20
  • 2
  • 2
Expression Type
  • 89
  • 41
  • 26
  • 2
Selectable Marker
  • 26
  • 26
  • 16
  • 1
Promoter
  • 43
  • 39
  • 22
  • 14
  • 6
Format
  • 69
  • 24
  • 17
  • 16
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alanine-Glyoxylate Aminotransferase 2-Like 1 (AGXT2L1)
Gene ID:
71760 (Mouse (Murine), AGXT2L1)
Synonyms:
ETNPPL, etnppl.L, etnppl, Etnppl
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3824039
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alanine-Glyoxylate Aminotransferase 2-Like 1 (AGXT2L1)
Gene ID:
71760 (Mouse (Murine), AGXT2L1)
Synonyms:
ETNPPL, etnppl.L, etnppl, Etnppl
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3824040
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alanine-Glyoxylate Aminotransferase 2-Like 1 (AGXT2L1)
Gene ID:
446472 (Xenopus laevis, AGXT2L1)
Synonyms:
ETNPPL, etnppl.L, etnppl, Etnppl
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3851062
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alanine-Glyoxylate Aminotransferase 2-Like 1 (AGXT2L1)
Gene ID:
100124921 (Xenopus tropicalis, AGXT2L1)
Synonyms:
ETNPPL, etnppl.L, etnppl, Etnppl
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4031886
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alanine-Glyoxylate Aminotransferase 2-Like 1 (AGXT2L1)
Gene ID:
515186 (Cow (Bovine), AGXT2L1)
Synonyms:
ETNPPL, etnppl.L, etnppl, Etnppl
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4062982
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Alanine-Glyoxylate Aminotransferase 2-Like 1 (AGXT2L1)
Gene ID:
64850 (Human, AGXT2L1)
Synonyms:
ETNPPL, etnppl.L, etnppl, Etnppl
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3469855
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Alanine-Glyoxylate Aminotransferase 2-Like 1 (AGXT2L1)
NCBI Accession:
XM_001087348
Species:
Rhesus Monkey
Synonyms:
ETNPPL, etnppl.L, etnppl, Etnppl
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3615169
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Alanine-Glyoxylate Aminotransferase 2-Like 1 (AGXT2L1)
NCBI Accession:
NM_027907
Species:
Mouse (Murine)
Synonyms:
ETNPPL, etnppl.L, etnppl, Etnppl
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3559791
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
Alanine-Glyoxylate Aminotransferase 2-Like 1
Species:
Mouse (Murine)
Synonyms:
MGC79033, AGXT2L1, 1300019H02Rik, AI195447, Agxt2l1, agxt2l1, zgc:63486
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196049
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alanine-Glyoxylate Aminotransferase 2-Like 1 (AGXT2L1)
Gene ID:
71760 (Mouse (Murine), AGXT2L1)
Synonyms:
ETNPPL, etnppl.L, etnppl, Etnppl
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3824038
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alanine-Glyoxylate Aminotransferase 2-Like 1 (AGXT2L1)
Gene ID:
71760 (Mouse (Murine), AGXT2L1)
Synonyms:
ETNPPL, etnppl.L, etnppl, Etnppl
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3824041
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alanine-Glyoxylate Aminotransferase 2-Like 1 (AGXT2L1)
Gene ID:
446472 (Xenopus laevis, AGXT2L1)
Synonyms:
ETNPPL, etnppl.L, etnppl, Etnppl
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3851061
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alanine-Glyoxylate Aminotransferase 2-Like 1 (AGXT2L1)
Gene ID:
100124921 (Xenopus tropicalis, AGXT2L1)
Synonyms:
ETNPPL, etnppl.L, etnppl, Etnppl
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4031887
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alanine-Glyoxylate Aminotransferase 2-Like 1 (AGXT2L1)
Gene ID:
515186 (Cow (Bovine), AGXT2L1)
Synonyms:
ETNPPL, etnppl.L, etnppl, Etnppl
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4062981
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Alanine-Glyoxylate Aminotransferase 2-Like 1 (AGXT2L1)
Gene ID:
64850 (Human, AGXT2L1)
Synonyms:
ETNPPL, etnppl.L, etnppl, Etnppl
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4213162
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Alanine-Glyoxylate Aminotransferase 2-Like 1 (AGXT2L1)
Gene ID:
64850 (Human, AGXT2L1)
Synonyms:
ETNPPL, etnppl.L, etnppl, Etnppl
Insert length:
1500 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5322651
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Alanine-Glyoxylate Aminotransferase 2-Like 1 (AGXT2L1)
Species:
Human
Synonyms:
ETNPPL, etnppl.L, etnppl, Etnppl
Insert length:
1500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4432981
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Alanine-Glyoxylate Aminotransferase 2-Like 1 (AGXT2L1)
Species:
Human
Synonyms:
ETNPPL, etnppl.L, etnppl, Etnppl
Insert length:
2000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3382409
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Alanine-Glyoxylate Aminotransferase 2-Like 1 (AGXT2L1)
Species:
Human
Synonyms:
ETNPPL, etnppl.L, etnppl, Etnppl
Insert length:
1500 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4697124
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Alanine-Glyoxylate Aminotransferase 2-Like 1 (AGXT2L1)
Species:
Human
Synonyms:
ETNPPL, etnppl.L, etnppl, Etnppl
Insert length:
1500 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4763554
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to AGXT2L1

  • ethanolamine-phosphate phospho-lyase (ETNPPL)
  • ethanolamine-phosphate phospho-lyase L homeolog (etnppl.L)
  • ethanolamine-phosphate phospho-lyase (etnppl)
  • ethanolamine phosphate phospholyase (Etnppl)
  • 1300019H02Rik
  • AGXT2L1
  • Agxt2l1
  • agxt2l1
  • AI195447
  • MGC79033
  • zgc:63486

Gene-IDs for different species

GENE IDSPECIES
428743 Gallus gallus
446472 Xenopus laevis
461428 Pan troglodytes
478511 Canis lupus familiaris
696880 Macaca mulatta
100011201 Monodelphis domestica
100124921 Xenopus (Silurana) tropicalis
100347168 Oryctolagus cuniculus
100395775 Callithrix jacchus
100448531 Pongo abelii
100590020 Nomascus leucogenys
515186 Bos taurus
71760 Mus musculus
64850 Homo sapiens
393421 Danio rerio

Protein level used designations for AGXT2L1

  • alanine-glyoxylate aminotransferase 2-like 1
  • alanine--glyoxylate aminotransferase 2-like 1
  • alanine--glyoxylate aminotransferase 2-like 1-like
  • ethanolamine-phosphate phospho-lyase
Other products related to AGXT2L1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com