AMER2 (APC Membrane Recruitment Protein 2, AMER2)

Short Description: Negative regulator of the canonical Wnt signaling pathway involved in neuroectodermal patterning. Acts by specifically binding phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2), translocating to the cell membrane and interacting with key regulators of the canonical Wnt signaling pathway, such as components of the beta-catenin destruction complex (By similarity).
More information related to gene AMER2.
Products related to AMER2 Gene:
83 Products
Type
  • 79
  • 4
Species
  • 42
  • 39
  • 2
Application
  • 44
  • 21
  • 16
  • 12
Fusion tag
  • 27
  • 15
  • 11
  • 9
  • 4
Vector Backbone
  • 7
  • 7
  • 5
  • 4
  • 4
Vector
  • 28
  • 26
  • 12
  • 7
  • 6
Insert
  • 34
  • 21
  • 12
  • 6
  • 4
Oligo-Type
  • 4
Resistance Gene
  • 33
  • 25
  • 18
  • 3
  • 2
Expression Type
  • 75
  • 36
Selectable Marker
  • 23
  • 16
Promoter
  • 32
  • 22
  • 13
  • 6
  • 6
Format
  • 32
  • 27
  • 16
  • 8

Type:
cDNA
Application:
Cloning
Gene:
APC Membrane Recruitment Protein 2 (AMER2)
Gene ID:
219287 (Human, AMER2)
Synonyms:
Amer2, AMER2, amer2
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3802751
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
APC Membrane Recruitment Protein 2 (AMER2)
Gene ID:
219287 (Human, AMER2)
Synonyms:
Amer2, AMER2, amer2
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3802750
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
APC Membrane Recruitment Protein 2 (AMER2)
NCBI Accession:
NM_152704,NP_689917
Species:
Human
Synonyms:
Amer2, AMER2, amer2
Insert length:
2016 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5490119
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 41 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
APC Membrane Recruitment Protein 2 (AMER2)
NCBI Accession:
NM_028113
Species:
Mouse (Murine)
Synonyms:
Amer2, AMER2, amer2
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Fam123a
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5174196
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
APC Membrane Recruitment Protein 2 (AMER2)
NCBI Accession:
NM_199138
Species:
Human
Synonyms:
Amer2, AMER2, amer2
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of FAM123A
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5174194
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Application:
RNA Interference
Gene:
APC Membrane Recruitment Protein 2
Species:
Mouse (Murine)
Synonyms:
2600011E07Rik, Fam123a, FAM123A, fam123a, zgc:165647
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • 2600011E07Rik (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3271338
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
APC Membrane Recruitment Protein 2
Species:
Human
Synonyms:
2600011E07Rik, Fam123a, FAM123A, fam123a, zgc:165647
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • AMER2 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3313462
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
APC Membrane Recruitment Protein 2 (AMER2)
Species:
Human
Synonyms:
Amer2, AMER2, amer2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-GFP
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5490117
$460.00
10 μg
Plus shipping costs $45.00
Will be delivered in 41 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
APC Membrane Recruitment Protein 2 (AMER2)
NCBI Accession:
NM_199138,NP_954589
Species:
Human
Synonyms:
Amer2, AMER2, amer2
Insert length:
1659 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5490120
$480.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
APC Membrane Recruitment Protein 2 (AMER2)
Gene ID:
219287 (Human, AMER2)
Synonyms:
Amer2, AMER2, amer2
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5051212

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5032267
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Cloning
Gene:
APC Membrane Recruitment Protein 2 (AMER2)
NCBI Accession:
NM_152704
Species:
Human
Synonyms:
Amer2, AMER2, amer2
Insert length:
2016 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5768442
$511.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Application:
RNA Interference
Gene:
APC Membrane Recruitment Protein 2
Gene ID:
72125 (Mouse (Murine), AMER2)
Synonyms:
2600011E07Rik, Fam123a, FAM123A, fam123a, zgc:165647
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5803703
$511.63
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days

Application:
RNA Interference
Gene:
APC Membrane Recruitment Protein 2
Gene ID:
219287 (Human, AMER2)
Synonyms:
2600011E07Rik, Fam123a, FAM123A, fam123a, zgc:165647
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5803704
$511.63
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
APC Membrane Recruitment Protein 2 (AMER2)
Species:
Human
Synonyms:
Amer2, AMER2, amer2
Insert length:
1601 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4564437
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
APC Membrane Recruitment Protein 2 (AMER2)
NCBI Accession:
NM_028113
Species:
Mouse (Murine)
Synonyms:
Amer2, AMER2, amer2
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Fam123a
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5289791
$520.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
APC Membrane Recruitment Protein 2 (AMER2)
NCBI Accession:
NM_199138
Species:
Human
Synonyms:
Amer2, AMER2, amer2
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of FAM123A
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5289789
$520.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
cDNA
Application:
Protein Expression
Gene:
APC Membrane Recruitment Protein 2 (AMER2)
Species:
Human
Synonyms:
Amer2, AMER2, amer2
Insert length:
1601 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4503230
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
APC Membrane Recruitment Protein 2 (AMER2)
Species:
Human
Synonyms:
Amer2, AMER2, amer2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-GFP
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5490118
$530.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
APC Membrane Recruitment Protein 2 (AMER2)
NCBI Accession:
NM_001164705
Species:
Mouse (Murine)
Synonyms:
Amer2, AMER2, amer2
Insert length:
1530 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4409722
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
APC Membrane Recruitment Protein 2 (AMER2)
NCBI Accession:
NM_001164705
Species:
Mouse (Murine)
Synonyms:
Amer2, AMER2, amer2
Insert length:
1530 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4443102
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to AMER2

  • APC membrane recruitment 2 (Amer2)
  • APC membrane recruitment protein 2 (AMER2)
  • APC membrane recruitment protein 2 (amer2)
  • 2600011E07Rik
  • Fam123a
  • FAM123A
  • fam123a
  • zgc:165647

Gene-IDs for different species

GENE IDSPECIES
72125 Mus musculus
219287 Homo sapiens
100101649 Danio rerio
418939 Gallus gallus

Protein level used designations for AMER2

  • APC membrane recruitment protein 2
  • family with sequence similarity 123, member A
  • protein FAM123A
  • family with sequence similarity 123A
  • amer2
Other products related to AMER2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com