AMH (Anti-Mullerian Hormone, AMH)

Short Description: Anti-Mullerian hormone is a member of the transforming growth factor-beta gene family which mediates male sexual differentiation. Anti-Mullerian hormone causes the regression of Mullerian ducts which would otherwise differentiate into the uterus and fallopian tubes. Some mutations in the anti-Mullerian hormone result in persistent Mullerian duct syndrome. [provided by RefSeq, Jul 2008].
More information related to gene AMH.
Products related to AMH Gene:
87 Products
Type
  • 83
  • 4
Species
  • 35
  • 27
  • 25
Application
  • 44
  • 24
  • 17
  • 16
Fusion tag
  • 28
  • 14
  • 9
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 5
  • 5
Vector
  • 33
  • 25
  • 12
  • 9
  • 3
Insert
  • 29
  • 20
  • 18
  • 8
  • 6
Oligo-Type
  • 4
Resistance Gene
  • 33
  • 30
  • 16
  • 4
  • 2
Expression Type
  • 82
  • 48
Selectable Marker
  • 26
  • 24
Promoter
  • 30
  • 28
  • 13
  • 8
  • 7
Format
  • 31
  • 27
  • 22
  • 7

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Anti-Mullerian Hormone (AMH)
Gene ID:
268 (Human, AMH)
Synonyms:
amh, AMH, Amh
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3470923
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Anti-Mullerian Hormone (AMH)
Gene ID:
268 (Human, AMH)
Synonyms:
amh, AMH, Amh
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3470924
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Anti-Mullerian Hormone (AMH)
NCBI Accession:
NM_000479,NP_000470
Species:
Human
Synonyms:
amh, AMH, Amh
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3382469
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Anti-Mullerian Hormone (AMH)
Gene ID:
11705 (Mouse (Murine), AMH)
Synonyms:
amh, AMH, Amh
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3407017
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Application:
RNA Interference
Gene:
Anti-Mullerian Hormone
Species:
Mouse (Murine)
Synonyms:
AMH, amh, MIF, MIS
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Amh (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3264811
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Anti-Mullerian Hormone
Species:
Human
Synonyms:
AMH, amh, MIF, MIS
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • AMH (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3339979
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Anti-Mullerian Hormone (AMH)
NCBI Accession:
NM_000479
Species:
Human
Synonyms:
amh, AMH, Amh
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of AMH
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5104873
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Anti-Mullerian Hormone (AMH)
NCBI Accession:
NM_007445
Species:
Mouse (Murine)
Synonyms:
amh, AMH, Amh
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Amh
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5104875
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Anti-Mullerian Hormone (AMH)
NCBI Accession:
NM_012902
Species:
Rat (Rattus)
Synonyms:
amh, AMH, Amh
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Amh
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5104877
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Anti-Mullerian Hormone (AMH)
Gene ID:
268 (Human, AMH)
Synonyms:
amh, AMH, Amh
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5053083

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5034138
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Cloning
Gene:
Anti-Mullerian Hormone (AMH)
NCBI Accession:
NM_000479
Species:
Human
Synonyms:
amh, AMH, Amh
Insert length:
1683 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5733116
$511.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Application:
RNA Interference
Gene:
Anti-Mullerian Hormone
Gene ID:
25378 (Rat (Rattus), AMH)
Synonyms:
AMH, amh, MIF, MIS
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5786968
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days

Application:
RNA Interference
Gene:
Anti-Mullerian Hormone
Gene ID:
268 (Human, AMH)
Synonyms:
AMH, amh, MIF, MIS
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5786969
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Anti-Mullerian Hormone (AMH)
NCBI Accession:
NM_000479
Species:
Human
Synonyms:
amh, AMH, Amh
Insert length:
1683 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4421752
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Anti-Mullerian Hormone (AMH)
NCBI Accession:
NM_000479
Species:
Human
Synonyms:
amh, AMH, Amh
Insert length:
1683 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4486838
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Anti-Mullerian Hormone (AMH)
Species:
Human
Synonyms:
amh, AMH, Amh
Insert length:
1683 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4498472
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Anti-Mullerian Hormone (AMH)
Species:
Human
Synonyms:
amh, AMH, Amh
Insert length:
1683 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4559681
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Anti-Mullerian Hormone (AMH)
NCBI Accession:
NM_000479
Species:
Human
Synonyms:
amh, AMH, Amh
Insert length:
1683 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4630309
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Anti-Mullerian Hormone (AMH)
NCBI Accession:
NM_000479
Species:
Human
Synonyms:
amh, AMH, Amh
Insert length:
1683 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4697268
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Anti-Mullerian Hormone (AMH)
NCBI Accession:
NM_000479
Species:
Human
Synonyms:
amh, AMH, Amh
Insert length:
1683 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4778530
$520.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to AMH

  • anti-Mullerian hormone (amh)
  • anti-Mullerian hormone (AMH)
  • anti-Mullerian hormone (Amh)
  • AMH
  • amh
  • MIF
  • MIS

Gene-IDs for different species

GENE IDSPECIES
493624 Danio rerio
750077 Pan troglodytes
100049306 Oryzias latipes
100462704 Gasterosteus aculeatus
100136452 Salmo salar
268 Homo sapiens
11705 Mus musculus
485072 Canis lupus familiaris
397578 Sus scrofa
280718 Bos taurus
25378 Rattus norvegicus
395887 Gallus gallus

Protein level used designations for AMH

  • muellerian-inhibiting factor
  • anti-Mullerian hormone
  • anti-mullerian hormone
  • Mullerian inhibiting factor
  • Mullerian inhibiting substance
  • anti-Muellerian hormone
  • muellerian-inhibiting substance
  • Mullerian inhibitory substance
  • MIS
  • Anti - Mullerian hormone (Mulerian inhibiting substance)
Other products related to AMH such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com