APOE (Apolipoprotein E, APOE)

Short Description: Chylomicron remnants and very low density lipoprotein (VLDL) remnants are rapidly removed from the circulation by receptor-mediated endocytosis in the liver. Apolipoprotein E, a main apoprotein of the chylomicron, binds to a specific receptor on liver cells and peripheral cells. ApoE is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. The APOE gene is mapped to chromosome 19 in a cluster with APOC1 and APOC2. Defects in apolipoprotein E result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants. [provided by RefSeq, Jul 2008].
More information related to gene APOE.
Products related to APOE Gene:
152 Products
Data Quality
  • 2
Type
  • 144
  • 8
Species
  • 56
  • 45
  • 41
  • 6
  • 4
Application
  • 94
  • 39
  • 27
  • 16
  • 2
Fusion tag
  • 62
  • 18
  • 16
  • 13
  • 8
Vector Backbone
  • 16
  • 7
  • 6
  • 6
  • 6
Vector
  • 73
  • 35
  • 12
  • 11
  • 9
Insert
  • 55
  • 52
  • 21
  • 8
  • 6
Oligo-Type
  • 6
  • 2
Resistance Gene
  • 68
  • 50
  • 22
  • 4
  • 2
Expression Type
  • 110
  • 51
  • 22
Selectable Marker
  • 31
  • 26
  • 22
Promoter
  • 42
  • 39
  • 31
  • 13
  • 8
Format
  • 77
  • 27
  • 26
  • 22

Type:
ORF
Application:
Cloning
Gene:
Apolipoprotein E (APOE)
Species:
Human
Synonyms:
apoe, apoea, Apoe, APOE
Insert length:
954 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5720459
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Apolipoprotein E (APOE)
NCBI Accession:
NM_000041,NP_000032
Species:
Human
Synonyms:
apoe, apoea, Apoe, APOE
Insert length:
954 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5336621
$98.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Apolipoprotein E (APOE)
Gene ID:
30314 (Zebrafish (Danio rerio), APOE)
Synonyms:
apoe, apoea, Apoe, APOE
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3875709
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Apolipoprotein E (APOE)
Gene ID:
25728 (Rat (Rattus), APOE)
Synonyms:
apoe, apoea, Apoe, APOE
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4046016
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Apolipoprotein E (APOE)
Gene ID:
348 (Human, APOE)
Synonyms:
apoe, apoea, Apoe, APOE
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083185
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Apolipoprotein E (APOE)
Gene ID:
281004 (Cow (Bovine), APOE)
Synonyms:
apoe, apoea, Apoe, APOE
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3838539
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Apolipoprotein E (APOE)
Gene ID:
281004 (Cow (Bovine), APOE)
Synonyms:
apoe, apoea, Apoe, APOE
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3838538
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Apolipoprotein E (APOE)
Gene ID:
25728 (Rat (Rattus), APOE)
Synonyms:
apoe, apoea, Apoe, APOE
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4036946
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Apolipoprotein E (APOE)
Gene ID:
11816 (Mouse (Murine), APOE)
Synonyms:
apoe, apoea, Apoe, APOE
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3462638
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Apolipoprotein E (APOE)
NCBI Accession:
NM_138828
Species:
Rat (Rattus)
Synonyms:
apoe, apoea, Apoe, APOE
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3556259
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Apolipoprotein E (APOE)
NCBI Accession:
NM_009696
Species:
Mouse (Murine)
Synonyms:
apoe, apoea, Apoe, APOE
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3556258
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Apolipoprotein E (APOE)
NCBI Accession:
NM_000041
Species:
Human
Synonyms:
apoe, apoea, Apoe, APOE
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3556257
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Apolipoprotein E
Species:
Human
Synonyms:
ad2, apoprotein, im:7036787, wu:fb69a05, zgc:110064, apoe, AI255918, AD2, LDLCQ5, LPG, APOEA, Apo-E
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189057
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Apolipoprotein E
Species:
Mouse (Murine)
Synonyms:
ad2, apoprotein, im:7036787, wu:fb69a05, zgc:110064, apoe, AI255918, AD2, LDLCQ5, LPG, APOEA, Apo-E
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194641
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Apolipoprotein E (APOE)
Gene ID:
30314 (Zebrafish (Danio rerio), APOE)
Synonyms:
apoe, apoea, Apoe, APOE
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3813683
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Apolipoprotein E (APOE)
Gene ID:
25728 (Rat (Rattus), APOE)
Synonyms:
apoe, apoea, Apoe, APOE
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4046017
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Apolipoprotein E (APOE)
Gene ID:
348 (Human, APOE)
Synonyms:
apoe, apoea, Apoe, APOE
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083186
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Apolipoprotein E (APOE)
Gene ID:
281004 (Cow (Bovine), APOE)
Synonyms:
apoe, apoea, Apoe, APOE
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3838540
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Apolipoprotein E (APOE)
Gene ID:
25728 (Rat (Rattus), APOE)
Synonyms:
apoe, apoea, Apoe, APOE
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4036947
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Apolipoprotein E (APOE)
Gene ID:
281004 (Cow (Bovine), APOE)
Synonyms:
apoe, apoea, Apoe, APOE
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3462108
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to APOE

  • apolipoprotein E (apoe)
  • apolipoprotein Ea (apoea)
  • apolipoprotein E (Apoe)
  • apolipoprotein E (APOE)
  • ad2
  • AD2
  • AI255918
  • Apo-E
  • apoe
  • APOEA
  • apoprotein
  • im:7036787
  • LDLCQ5
  • LPG
  • wu:fb69a05
  • zgc:110064

Gene-IDs for different species

GENE IDSPECIES
394678 Xenopus (Silurana) tropicalis
553587 Danio rerio
100136023 Oncorhynchus mykiss
100380959 Xenopus laevis
11816 Mus musculus
348 Homo sapiens
100009337 Oryctolagus cuniculus
25728 Rattus norvegicus
397576 Sus scrofa
100731633 Cavia porcellus
281004 Bos taurus
476438 Canis lupus familiaris
449586 Pan troglodytes
714623 Macaca mulatta

Protein level used designations for APOE

  • apolipoprotein E
  • ApoE-1
  • apo-E
  • apolipoprotein E3
Other products related to APOE such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com