ASB10 (Ankyrin Repeat and SOCS Box-Containing 10, ASB10)

Short Description: The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. The SOCS box serves to couple suppressor of cytokine signaling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2008].
More information related to gene ASB10.
Products related to ASB10 Gene:
117 Products
Type
  • 112
  • 5
Species
  • 55
  • 32
  • 28
  • 2
Application
  • 66
  • 26
  • 25
  • 16
Fusion tag
  • 41
  • 21
  • 16
  • 9
  • 8
Vector Backbone
  • 10
  • 9
  • 9
  • 6
  • 6
Vector
  • 42
  • 37
  • 12
  • 9
  • 9
Insert
  • 39
  • 37
  • 20
  • 8
  • 6
Oligo-Type
  • 5
Resistance Gene
  • 43
  • 39
  • 24
  • 6
  • 2
Expression Type
  • 103
  • 54
Selectable Marker
  • 38
  • 26
  • 1
Promoter
  • 44
  • 30
  • 12
  • 10
  • 8
Format
  • 49
  • 27
  • 24
  • 17

Type:
cDNA
Application:
Cloning
Gene:
Ankyrin Repeat and SOCS Box-Containing 10 (ASB10)
Gene ID:
136371 (Human, ASB10)
Synonyms:
asb10, ASB10, Asb10
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4011501
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ankyrin Repeat and SOCS Box-Containing 10 (ASB10)
Gene ID:
499972 (Rat (Rattus), ASB10)
Synonyms:
asb10, ASB10, Asb10
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4060720
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ankyrin Repeat and SOCS Box-Containing 10 (ASB10)
Gene ID:
117590 (Mouse (Murine), ASB10)
Synonyms:
asb10, ASB10, Asb10
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4011086
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ankyrin Repeat and SOCS Box-Containing 10 (ASB10)
Gene ID:
117590 (Mouse (Murine), ASB10)
Synonyms:
asb10, ASB10, Asb10
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4011087
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ankyrin Repeat and SOCS Box-Containing 10 (ASB10)
Gene ID:
136371 (Human, ASB10)
Synonyms:
asb10, ASB10, Asb10
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4011502
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ankyrin Repeat and SOCS Box-Containing 10 (ASB10)
Gene ID:
499972 (Rat (Rattus), ASB10)
Synonyms:
asb10, ASB10, Asb10
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4060721
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ankyrin Repeat and SOCS Box-Containing 10 (ASB10)
Gene ID:
117590 (Mouse (Murine), ASB10)
Synonyms:
asb10, ASB10, Asb10
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4011085
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ankyrin Repeat and SOCS Box-Containing 10 (ASB10)
Gene ID:
117590 (Mouse (Murine), ASB10)
Synonyms:
asb10, ASB10, Asb10
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4011084
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Ankyrin Repeat and SOCS Box-Containing 10 (ASB10)
Gene ID:
136371 (Human, ASB10)
Synonyms:
asb10, ASB10, Asb10
Insert length:
1404 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5324823
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Ankyrin Repeat and SOCS Box-Containing 10 (ASB10)
Gene ID:
136371 (Human, ASB10)
Synonyms:
asb10, ASB10, Asb10
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3398513
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Ankyrin Repeat and SOCS Box-Containing 10 (ASB10)
Gene ID:
136371 (Human, ASB10)
Synonyms:
asb10, ASB10, Asb10
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3428146
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Ankyrin Repeat and SOCS Box-Containing 10 (ASB10)
NCBI Accession:
NM_001142460,NP_001135932
Species:
Human
Synonyms:
asb10, ASB10, Asb10
Insert length:
1425 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5392825
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Application:
RNA Interference
Gene:
Ankyrin Repeat and SOCS Box-Containing 10
Species:
Rat (Rattus)
Synonyms:
zgc:153279, GLC1F, Asb-10, BB137407, RGD1562922
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Asb10 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3352576
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Ankyrin Repeat and SOCS Box-Containing 10
Species:
Human
Synonyms:
zgc:153279, GLC1F, Asb-10, BB137407, RGD1562922
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • ASB10 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3312258
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Ankyrin Repeat and SOCS Box-Containing 10
Species:
Mouse (Murine)
Synonyms:
zgc:153279, GLC1F, Asb-10, BB137407, RGD1562922
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Asb10 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3271226
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Ankyrin Repeat and SOCS Box-Containing 10 (ASB10)
NCBI Accession:
NM_080871
Species:
Human
Synonyms:
asb10, ASB10, Asb10
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ASB10
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5114064
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Ankyrin Repeat and SOCS Box-Containing 10 (ASB10)
NCBI Accession:
NM_080444
Species:
Mouse (Murine)
Synonyms:
asb10, ASB10, Asb10
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Asb10
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5114066
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Ankyrin Repeat and SOCS Box-Containing 10 (ASB10)
NCBI Accession:
NM_001109216
Species:
Rat (Rattus)
Synonyms:
asb10, ASB10, Asb10
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Asb10
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5114068
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
cDNA
Application:
Protein Expression
Gene:
Ankyrin Repeat and SOCS Box-Containing 10 (ASB10)
Species:
Human
Synonyms:
asb10, ASB10, Asb10
Insert length:
1404 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4483830
$450.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ankyrin Repeat and SOCS Box-Containing 10 (ASB10)
Species:
Human
Synonyms:
asb10, ASB10, Asb10
Insert length:
1404 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4627301
$450.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ASB10

  • ankyrin repeat and SOCS box containing 10 (asb10)
  • ankyrin repeat and SOCS box containing 10 (ASB10)
  • ankyrin repeat and SOCS box-containing 10 (Asb10)
  • Asb-10
  • BB137407
  • GLC1F
  • RGD1562922
  • zgc:153279

Gene-IDs for different species

GENE IDSPECIES
559467 Danio rerio
768438 Gallus gallus
100444374 Pongo abelii
136371 Homo sapiens
482804 Canis lupus familiaris
616286 Bos taurus
117590 Mus musculus
499972 Rattus norvegicus

Protein level used designations for ASB10

  • ankyrin repeat and SOCS box protein 10
  • ankyrin repeat and SOCS box-containing 10
  • ankyrin repeat and SOCS box protein 10-like
  • ankyrin repeat and SOCS box-containing protein 10
Other products related to ASB10 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com