ASCL3 (Achaete-Scute Complex Homolog 3 (Drosophila), ASCL3)

Short Description: Transcriptional repressor. Inhibits myogenesis (By similarity).
More information related to gene ASCL3.
Products related to ASCL3 Gene:
59 Products
Type
  • 55
  • 4
Species
  • 32
  • 26
  • 1
Application
  • 28
  • 18
  • 12
  • 9
Fusion tag
  • 24
  • 11
  • 7
  • 6
  • 3
Vector Backbone
  • 4
  • 4
  • 4
  • 4
  • 4
Vector
  • 24
  • 14
  • 6
  • 5
  • 4
Insert
  • 15
  • 14
  • 14
  • 6
  • 4
Oligo-Type
  • 4
Resistance Gene
  • 21
  • 19
  • 12
  • 3
  • 2
Expression Type
  • 49
  • 30
Selectable Marker
  • 18
  • 14
  • 4
Promoter
  • 22
  • 17
  • 6
  • 5
  • 5
Format
  • 26
  • 15
  • 9
  • 9
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Achaete-Scute Complex Homolog 3 (Drosophila) (ASCL3)
NCBI Accession:
NM_020646
Gene ID:
56676 (Human, ASCL3)
Synonyms:
ASCL3, Ascl3
Insert length:
546 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4932993
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Achaete-Scute Complex Homolog 3 (Drosophila) (ASCL3)
Gene ID:
56787 (Mouse (Murine), ASCL3)
Synonyms:
ASCL3, Ascl3
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3989752
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Achaete-Scute Complex Homolog 3 (Drosophila) (ASCL3)
Gene ID:
56787 (Mouse (Murine), ASCL3)
Synonyms:
ASCL3, Ascl3
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3989753
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Achaete-Scute Complex Homolog 3 (Drosophila) (ASCL3)
Gene ID:
56787 (Mouse (Murine), ASCL3)
Synonyms:
ASCL3, Ascl3
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3989751
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Achaete-Scute Complex Homolog 3 (Drosophila) (ASCL3)
Gene ID:
56787 (Mouse (Murine), ASCL3)
Synonyms:
ASCL3, Ascl3
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3989750
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Achaete-Scute Complex Homolog 3 (Drosophila) (ASCL3)
NCBI Accession:
NM_001271234,NP_001258163
Species:
Rat (Rattus)
Synonyms:
ASCL3, Ascl3
Insert length:
525 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3299170
$200.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Achaete-Scute Complex Homolog 3 (Drosophila) (ASCL3)
Gene ID:
56676 (Human, ASCL3)
Synonyms:
ASCL3, Ascl3
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3415853
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Achaete-Scute Complex Homolog 3 (Drosophila) (ASCL3)
Gene ID:
56676 (Human, ASCL3)
Synonyms:
ASCL3, Ascl3
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3416040
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Achaete-Scute Complex Homolog 3 (Drosophila) (ASCL3)
NCBI Accession:
NM_020646,NP_065697
Species:
Human
Synonyms:
ASCL3, Ascl3
Insert length:
500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3388304
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Achaete-Scute Complex Homolog 3 (Drosophila) (ASCL3)
NCBI Accession:
NM_020051,NP_064435
Species:
Mouse (Murine)
Synonyms:
ASCL3, Ascl3
Insert length:
525 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3299169
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Achaete-Scute Complex Homolog 3 (Drosophila) (ASCL3)
NCBI Accession:
NM_020646,NP_065697
Species:
Human
Synonyms:
ASCL3, Ascl3
Insert length:
546 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5422092
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Application:
RNA Interference
Gene:
Achaete-Scute Complex Homolog 3 (Drosophila)
Species:
Mouse (Murine)
Synonyms:
HASH3, SGN1, bHLHa42, Sgn1, ASCL3-like, ASH3A
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Ascl3 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3278111
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Achaete-Scute Complex Homolog 3 (Drosophila)
Species:
Human
Synonyms:
HASH3, SGN1, bHLHa42, Sgn1, ASCL3-like, ASH3A
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • ASCL3 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3287228
$420.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Achaete-Scute Complex Homolog 3 (Drosophila) (ASCL3)
NCBI Accession:
NM_020646
Species:
Human
Synonyms:
ASCL3, Ascl3
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ASCL3
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5130750
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Achaete-Scute Complex Homolog 3 (Drosophila) (ASCL3)
NCBI Accession:
NM_020051
Species:
Mouse (Murine)
Synonyms:
ASCL3, Ascl3
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Ascl3
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5130752
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
Achaete-Scute Complex Homolog 3 (Drosophila) (ASCL3)
Species:
Human
Synonyms:
ASCL3, Ascl3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-GFP
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5422091
$460.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Achaete-Scute Complex Homolog 3 (Drosophila) (ASCL3)
Gene ID:
56676 (Human, ASCL3)
Synonyms:
ASCL3, Ascl3
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5059151

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5040206
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Achaete-Scute Complex Homolog 3 (Drosophila)
Gene ID:
56787 (Mouse (Murine), ASCL3)
Synonyms:
HASH3, SGN1, bHLHa42, Sgn1, ASCL3-like, ASH3A
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5794123
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days

Application:
RNA Interference
Gene:
Achaete-Scute Complex Homolog 3 (Drosophila)
Gene ID:
56676 (Human, ASCL3)
Synonyms:
HASH3, SGN1, bHLHa42, Sgn1, ASCL3-like, ASH3A
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5794124
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Achaete-Scute Complex Homolog 3 (Drosophila) (ASCL3)
NCBI Accession:
NM_020646
Species:
Human
Synonyms:
ASCL3, Ascl3
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ASCL3
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5246203
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to ASCL3

  • achaete-scute family bHLH transcription factor 3 (ASCL3)
  • achaete-scute family bHLH transcription factor 3 (Ascl3)
  • ASCL3-like
  • ASH3A
  • bHLHa42
  • HASH3
  • SGN1
  • Sgn1

Gene-IDs for different species

GENE IDSPECIES
56676 Homo sapiens
56787 Mus musculus
786757 Bos taurus
101106621 Ovis aries
100728191 Cavia porcellus
246301 Rattus norvegicus
100686513 Canis lupus familiaris
100518920 Sus scrofa

Protein level used designations for ASCL3

  • ASH-3
  • achaete-scute homolog 3
  • bHLH transcription factor Sgn-1 (Salivary Glands 1)
  • bHLH transcriptional regulator Sgn-1
  • class A basic helix-loop-helix protein 42
  • ICRFP703B1614Q5.4
  • ICRFP703N2430Q5.4
  • achaete-scute complex homolog-like 3
  • mASH-3
  • mASH3
  • achaete-scute complex homolog 3
Other products related to ASCL3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com