B3GALT2 (UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 2, B3GALT2)

Short Description: This gene is a member of the beta-1,3-galactosyltransferase (beta3GalT) gene family. This family encodes type II membrane-bound glycoproteins with diverse enzymatic functions using different donor substrates (UDP-galactose and UDP-N-acetylglucosamine) and different acceptor sugars (N-acetylglucosamine, galactose, N-acetylgalactosamine). The beta3GalT genes are distantly related to the Drosophila Brainiac gene and have the protein coding sequence contained in a single exon. The beta3GalT proteins also contain conserved sequences not found in the beta4GalT or alpha3GalT proteins. The carbohydrate chains synthesized by these enzymes are designated as type 1, whereas beta4GalT enzymes synthesize type 2 carbohydrate chains. The ratio of type 1:type 2 chains changes during embryogenesis. By sequence similarity, the beta3GalT genes fall into at least two groups: beta3GalT4 and 4 other beta3GalT genes (beta3GalT1-3, beta3GalT5). This gene encodes a protein that functions in N-linked glycoprotein glycosylation and shows strict donor substrate specificity for UDP-galactose. [provided by RefSeq, Jul 2008].
More information related to gene B3GALT2.
Products related to B3GALT2 Gene:
Type
  • 104
  • 4
Species
  • 49
  • 26
  • 25
  • 2
  • 2
Application
  • 66
  • 26
  • 21
  • 16
  • 1
Fusion tag
  • 38
  • 13
  • 11
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 41
  • 36
  • 12
  • 9
  • 3
Insert
  • 39
  • 31
  • 18
  • 8
  • 6
Oligo-Type
  • 3
  • 1
Resistance Gene
  • 43
  • 40
  • 18
  • 3
  • 2
Expression Type
  • 87
  • 47
  • 11
Selectable Marker
  • 26
  • 21
  • 11
  • 1
Promoter
  • 28
  • 28
  • 26
  • 13
  • 8
Format
  • 43
  • 24
  • 22
  • 19
108 Products

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 2 (B3GALT2)
Gene ID:
404633 (Zebrafish (Danio rerio), B3GALT2)
Synonyms:
b3galt2, b3galt2.S, B3GALT2, B3galt2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3877844
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 2 (B3GALT2)
Gene ID:
539815 (Cow (Bovine), B3GALT2)
Synonyms:
b3galt2, b3galt2.S, B3GALT2, B3galt2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3864027
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 2 (B3GALT2)
Gene ID:
26878 (Mouse (Murine), B3GALT2)
Synonyms:
b3galt2, b3galt2.S, B3GALT2, B3galt2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3875656
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 2 (B3GALT2)
Gene ID:
447391 (Xenopus laevis, B3GALT2)
Synonyms:
b3galt2, b3galt2.S, B3GALT2, B3galt2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3884461
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 2 (B3GALT2)
Gene ID:
448276 (Xenopus tropicalis, B3GALT2)
Synonyms:
b3galt2, b3galt2.S, B3GALT2, B3galt2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4058673
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 2 (B3GALT2)
Gene ID:
8707 (Human, B3GALT2)
Synonyms:
b3galt2, b3galt2.S, B3GALT2, B3galt2
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211740
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 2 (B3GALT2)
Species:
Human
Synonyms:
b3galt2, b3galt2.S, B3GALT2, B3galt2
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3887532
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 2
Species:
Human
Synonyms:
zgc:76904, beta3gal-t2, beta3galt2, glct2, b3galt2, MGC89037, B3GALT2, BETA3GALT2, GLCT2, beta3Gal-T2
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3191438
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 2 (B3GALT2)
Gene ID:
404633 (Zebrafish (Danio rerio), B3GALT2)
Synonyms:
b3galt2, b3galt2.S, B3GALT2, B3galt2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3847260
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 2 (B3GALT2)
Gene ID:
26878 (Mouse (Murine), B3GALT2)
Synonyms:
b3galt2, b3galt2.S, B3GALT2, B3galt2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3812626
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 2 (B3GALT2)
Gene ID:
539815 (Cow (Bovine), B3GALT2)
Synonyms:
b3galt2, b3galt2.S, B3GALT2, B3galt2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3864028
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 2 (B3GALT2)
Gene ID:
447391 (Xenopus laevis, B3GALT2)
Synonyms:
b3galt2, b3galt2.S, B3GALT2, B3galt2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3884462
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 2 (B3GALT2)
Gene ID:
448276 (Xenopus tropicalis, B3GALT2)
Synonyms:
b3galt2, b3galt2.S, B3GALT2, B3galt2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4058674
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 2 (B3GALT2)
Gene ID:
8707 (Human, B3GALT2)
Synonyms:
b3galt2, b3galt2.S, B3GALT2, B3galt2
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211739
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 2 (B3GALT2)
Gene ID:
8707 (Human, B3GALT2)
Synonyms:
b3galt2, b3galt2.S, B3GALT2, B3galt2
Insert length:
1269 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5314732
$189.37
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 2 (B3GALT2)
Species:
Human
Synonyms:
b3galt2, b3galt2.S, B3GALT2, B3galt2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3963123
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 2 (B3GALT2)
Species:
Human
Synonyms:
b3galt2, b3galt2.S, B3GALT2, B3galt2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3963125
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 2 (B3GALT2)
Species:
Human
Synonyms:
b3galt2, b3galt2.S, B3GALT2, B3galt2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3963126
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 2 (B3GALT2)
Species:
Human
Synonyms:
b3galt2, b3galt2.S, B3GALT2, B3galt2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3963127
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 2 (B3GALT2)
Species:
Human
Synonyms:
b3galt2, b3galt2.S, B3GALT2, B3galt2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948170

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3963129
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to B3GALT2

  • UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2 (b3galt2)
  • Beta-1,3-galactosyltransferase 2 S homeolog (b3galt2.S)
  • beta-1,3-galactosyltransferase 2 (B3GALT2)
  • UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2 (B3galt2)
  • Beta-1,3-galactosyltransferase 2 (B3galt2)
  • B3GALT2
  • b3galt2
  • beta3gal-t2
  • beta3Gal-T2
  • beta3galt2
  • BETA3GALT2
  • glct2
  • GLCT2
  • MGC89037
  • zgc:76904

Gene-IDs for different species

GENE IDSPECIES
404633 Danio rerio
447391 Xenopus laevis
448276 Xenopus (Silurana) tropicalis
469624 Pan troglodytes
539815 Bos taurus
607356 Canis lupus familiaris
712334 Macaca mulatta
769122 Gallus gallus
100348508 Oryctolagus cuniculus
100380178 Xenopus (Silurana) tropicalis
8707 Homo sapiens
26878 Mus musculus
686081 Rattus norvegicus
100173654 Pongo abelii
101121025 Ovis aries

Protein level used designations for B3GALT2

  • beta-1,3-galactosyltransferase 2
  • UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2
  • UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase 2
  • UDP-galactose:2-acetamido-2-deoxy-D-glucose 3beta-galactosyltransferase 2
  • beta-1,3-GalTase 2
  • beta-3-galt2
  • UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase-II
  • beta3Gal-T2
  • beta3GalT2
Other products related to B3GALT2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com