BAD (BCL2-Associated Agonist of Cell Death, BAD)

Short Description: The protein encoded by this gene is a member of the BCL-2 family. BCL-2 family members are known to be regulators of programmed cell death. This protein positively regulates cell apoptosis by forming heterodimers with BCL-xL and BCL-2, and reversing their death repressor activity. Proapoptotic activity of this protein is regulated through its phosphorylation. Protein kinases AKT and MAP kinase, as well as protein phosphatase calcineurin were found to be involved in the regulation of this protein. Alternative splicing of this gene results in two transcript variants which encode the same isoform. [provided by RefSeq, Jul 2008].
More information related to gene BAD.
Products related to BAD Gene:
144 Products
Data Quality
  • 1
  • 136
  • 8
  • 64
  • 44
  • 30
  • 4
  • 2
  • 91
  • 30
  • 27
  • 16
  • 2
Fusion tag
  • 51
  • 19
  • 13
  • 13
  • 8
Vector Backbone
  • 8
  • 8
  • 6
  • 6
  • 6
  • 64
  • 40
  • 12
  • 9
  • 5
  • 56
  • 43
  • 21
  • 8
  • 6
  • 6
  • 2
Resistance Gene
  • 62
  • 45
  • 24
  • 5
  • 2
Expression Type
  • 102
  • 51
  • 26
Selectable Marker
  • 27
  • 26
  • 26
  • 1
  • 40
  • 37
  • 31
  • 14
  • 8
  • 73
  • 27
  • 24
  • 20

Protein Expression
BCL2-Associated Agonist of Cell Death (BAD)
NCBI Accession:
badb, BAD, Bad
Insert length:
507 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5393658
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression
BCL2-Associated Agonist of Cell Death (BAD)
NCBI Accession:
badb, BAD, Bad
Insert length:
507 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5393659
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

BCL2-Associated Agonist of Cell Death (BAD)
Gene ID:
572 (Human, BAD)
badb, BAD, Bad
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4083340
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
BCL2-Associated Agonist of Cell Death (BAD)
Gene ID:
64639 (Rat (Rattus), BAD)
badb, BAD, Bad
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3879430
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
BCL2-Associated Agonist of Cell Death (BAD)
Gene ID:
615013 (Cow (Bovine), BAD)
badb, BAD, Bad
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3866372
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
BCL2-Associated Agonist of Cell Death (BAD)
Gene ID:
572 (Human, BAD)
badb, BAD, Bad
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3875079
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

BCL2-Associated Agonist of Cell Death (BAD)
NCBI Accession:
badb, BAD, Bad
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:

Sequencing Primer:
  • M13-47
  • RV-M
Catalog No. ABIN3886372
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

BCL2-Associated Agonist of Cell Death (BAD)
Mouse (Murine)
badb, BAD, Bad
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3557678
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Quantitative real-time PCR
BCL2-Associated Agonist of Cell Death
bad, fa01b12, wu:fa01b12, wu:fa96d04, BAD, BBC2, BCL2L8, AI325008, Bbc2
-20 °C
Catalog No. ABIN3188452
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Quantitative real-time PCR
BCL2-Associated Agonist of Cell Death
Mouse (Murine)
bad, fa01b12, wu:fa01b12, wu:fa96d04, BAD, BBC2, BCL2L8, AI325008, Bbc2
-20 °C
Catalog No. ABIN3194884
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

BCL2-Associated Agonist of Cell Death (BAD)
badb, BAD, Bad
Insert length:
507 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5738247
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

BCL2-Associated Agonist of Cell Death (BAD)
Gene ID:
572 (Human, BAD)
badb, BAD, Bad
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4083339
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
BCL2-Associated Agonist of Cell Death (BAD)
Gene ID:
64639 (Rat (Rattus), BAD)
badb, BAD, Bad
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3879431
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
BCL2-Associated Agonist of Cell Death (BAD)
Gene ID:
615013 (Cow (Bovine), BAD)
badb, BAD, Bad
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3866373
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
BCL2-Associated Agonist of Cell Death (BAD)
Gene ID:
572 (Human, BAD)
badb, BAD, Bad
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3471071
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

BCL2-Associated Agonist of Cell Death (BAD)
Gene ID:
572 (Human, BAD)
badb, BAD, Bad
Insert length:
507 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5313989
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Protein Expression
BCL2-Associated Agonist of Cell Death (BAD)
NCBI Accession:
Mouse (Murine)
badb, BAD, Bad
Insert length:
489 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3299717
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Protein Expression
BCL2-Associated Agonist of Cell Death (BAD)
badb, BAD, Bad
Insert length:
507 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4433575
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
BCL2-Associated Agonist of Cell Death (BAD)
badb, BAD, Bad
Insert length:
507 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4472480
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

BCL2-Associated Agonist of Cell Death (BAD)
badb, BAD, Bad
Insert length:
507 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4758855
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to BAD

  • BCL2-associated agonist of cell death b (badb)
  • BCL2 associated agonist of cell death (BAD)
  • BCL2-associated agonist of cell death (Bad)
  • AI325008
  • bad
  • BAD
  • BBC2
  • Bbc2
  • BCL2L8
  • fa01b12
  • wu:fa01b12
  • wu:fa96d04

Gene-IDs for different species

58100 Danio rerio
768269 Felis catus
780444 Ovis aries
572 Homo sapiens
12015 Mus musculus
64639 Rattus norvegicus
483763 Canis lupus familiaris
615013 Bos taurus

Protein level used designations for BAD

  • proapoptotic BH3-only protein
  • BCL2-antagonist of cell death
  • BCL2-associated agonist of cell death
  • BCL-X/BCL-2 binding protein
  • BCL2-antagonist of cell death protein
  • BCL2-binding component 6
  • BCL2-binding protein
  • bcl-2-binding component 6
  • bcl-2-like protein 8
  • bcl-XL/Bcl-2-associated death promoter
  • bcl2 antagonist of cell death
  • bcl2-L-8
  • Bcl-associated death promoter
  • bcl-xL/Bcl-2-associated death promoter
  • Bcl2-antagonist of cell death
  • bcl-2 associated death agonist
  • bcl2-associated death promoter
Other products related to BAD such as antibodies, ELISA kits and high-purity proteins are available on our partner website