BAD (BCL2-Associated Agonist of Cell Death, BAD)

Short Description: The protein encoded by this gene is a member of the BCL-2 family. BCL-2 family members are known to be regulators of programmed cell death. This protein positively regulates cell apoptosis by forming heterodimers with BCL-xL and BCL-2, and reversing their death repressor activity. Proapoptotic activity of this protein is regulated through its phosphorylation. Protein kinases AKT and MAP kinase, as well as protein phosphatase calcineurin were found to be involved in the regulation of this protein. Alternative splicing of this gene results in two transcript variants which encode the same isoform. [provided by RefSeq, Jul 2008].
More information related to gene BAD.
Products related to BAD Gene:
144 Products
Data Quality
  • 1
  • 1
Type
  • 136
  • 8
Species
  • 64
  • 44
  • 30
  • 4
  • 2
Application
  • 91
  • 30
  • 27
  • 16
  • 2
Fusion tag
  • 51
  • 19
  • 13
  • 13
  • 8
Vector Backbone
  • 8
  • 8
  • 6
  • 6
  • 6
Vector
  • 64
  • 40
  • 12
  • 9
  • 5
Insert
  • 56
  • 43
  • 21
  • 8
  • 6
Oligo-Type
  • 6
  • 2
Resistance Gene
  • 62
  • 45
  • 24
  • 5
  • 2
Expression Type
  • 102
  • 51
  • 26
Selectable Marker
  • 27
  • 26
  • 26
  • 1
Promoter
  • 40
  • 37
  • 31
  • 14
  • 8
Format
  • 73
  • 27
  • 24
  • 20

Type:
ORF
Application:
Protein Expression
Gene:
BCL2-Associated Agonist of Cell Death (BAD)
NCBI Accession:
NM_004322,NP_004313
Species:
Human
Synonyms:
badb, BAD, Bad
Insert length:
507 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5393658
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
BCL2-Associated Agonist of Cell Death (BAD)
NCBI Accession:
NM_032989,NP_116784
Species:
Human
Synonyms:
badb, BAD, Bad
Insert length:
507 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5393659
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
BCL2-Associated Agonist of Cell Death (BAD)
Gene ID:
572 (Human, BAD)
Synonyms:
badb, BAD, Bad
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3875079
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
BCL2-Associated Agonist of Cell Death (BAD)
Gene ID:
615013 (Cow (Bovine), BAD)
Synonyms:
badb, BAD, Bad
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3866372
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
BCL2-Associated Agonist of Cell Death (BAD)
Gene ID:
572 (Human, BAD)
Synonyms:
badb, BAD, Bad
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083340
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
BCL2-Associated Agonist of Cell Death (BAD)
Gene ID:
64639 (Rat (Rattus), BAD)
Synonyms:
badb, BAD, Bad
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3879430
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
BCL2-Associated Agonist of Cell Death (BAD)
NCBI Accession:
NM_004322
Species:
Human
Synonyms:
badb, BAD, Bad
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3886372
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
BCL2-Associated Agonist of Cell Death (BAD)
Species:
Mouse (Murine)
Synonyms:
badb, BAD, Bad
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3557678
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Application:
Quantitative real-time PCR
Gene:
BCL2-Associated Agonist of Cell Death
Species:
Human
Synonyms:
bad, fa01b12, wu:fa01b12, wu:fa96d04, BAD, BBC2, BCL2L8, AI325008, Bbc2
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188452
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
BCL2-Associated Agonist of Cell Death
Species:
Mouse (Murine)
Synonyms:
bad, fa01b12, wu:fa01b12, wu:fa96d04, BAD, BBC2, BCL2L8, AI325008, Bbc2
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194884
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
ORF
Application:
Cloning
Gene:
BCL2-Associated Agonist of Cell Death (BAD)
Species:
Human
Synonyms:
badb, BAD, Bad
Insert length:
507 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5738247
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
BCL2-Associated Agonist of Cell Death (BAD)
Gene ID:
615013 (Cow (Bovine), BAD)
Synonyms:
badb, BAD, Bad
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3866373
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
BCL2-Associated Agonist of Cell Death (BAD)
Gene ID:
572 (Human, BAD)
Synonyms:
badb, BAD, Bad
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083339
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
BCL2-Associated Agonist of Cell Death (BAD)
Gene ID:
64639 (Rat (Rattus), BAD)
Synonyms:
badb, BAD, Bad
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3879431
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
BCL2-Associated Agonist of Cell Death (BAD)
Gene ID:
572 (Human, BAD)
Synonyms:
badb, BAD, Bad
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3471071
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
BCL2-Associated Agonist of Cell Death (BAD)
Gene ID:
572 (Human, BAD)
Synonyms:
badb, BAD, Bad
Insert length:
507 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5313989
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
BCL2-Associated Agonist of Cell Death (BAD)
NCBI Accession:
NM_001285453,NP_001272382
Species:
Mouse (Murine)
Synonyms:
badb, BAD, Bad
Insert length:
489 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3299717
$200.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
BCL2-Associated Agonist of Cell Death (BAD)
NCBI Accession:
NM_004322,NP_004313
Species:
Human
Synonyms:
badb, BAD, Bad
Insert length:
1110 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Cain, Hauptschein, Stewart, Bagci, Sahagian, Jay: "Identification of CD44 as a surface biomarker for drug resistance by surface proteome signature technology." in: Molecular cancer research : MCR, Vol. 9, Issue 5, pp. 637-47, 2011 (Pubmed)
  • Anderson, Sutherland, Butt: "BAG-1 overexpression attenuates luminal apoptosis in MCF-10A mammary epithelial cells through enhanced RAF-1 activation." in: Oncogene, Vol. 29, Issue 4, pp. 527-38, 2010 (Pubmed)
Catalog No. ABIN3382708
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
BCL2-Associated Agonist of Cell Death (BAD)
NCBI Accession:
NM_032989,NP_116784
Species:
Human
Synonyms:
badb, BAD, Bad
Insert length:
1090 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3382709
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
BCL2-Associated Agonist of Cell Death (BAD)
Species:
Human
Synonyms:
badb, BAD, Bad
Insert length:
507 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4697978
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to BAD

  • BCL2-associated agonist of cell death b (badb)
  • BCL2 associated agonist of cell death (BAD)
  • BCL2-associated agonist of cell death (Bad)
  • AI325008
  • bad
  • BAD
  • BBC2
  • Bbc2
  • BCL2L8
  • fa01b12
  • wu:fa01b12
  • wu:fa96d04

Gene-IDs for different species

GENE IDSPECIES
58100 Danio rerio
768269 Felis catus
780444 Ovis aries
572 Homo sapiens
12015 Mus musculus
64639 Rattus norvegicus
483763 Canis lupus familiaris
615013 Bos taurus

Protein level used designations for BAD

  • proapoptotic BH3-only protein
  • BCL2-antagonist of cell death
  • BCL2-associated agonist of cell death
  • BCL-X/BCL-2 binding protein
  • BCL2-antagonist of cell death protein
  • BCL2-binding component 6
  • BCL2-binding protein
  • bcl-2-binding component 6
  • bcl-2-like protein 8
  • bcl-XL/Bcl-2-associated death promoter
  • bcl2 antagonist of cell death
  • bcl2-L-8
  • Bcl-associated death promoter
  • bcl-xL/Bcl-2-associated death promoter
  • Bcl2-antagonist of cell death
  • bcl-2 associated death agonist
  • bcl2-associated death promoter
Other products related to BAD such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com