CCL5 (Chemokine (C-C Motif) Ligand 5, CCL5)

Short Description: This gene is one of several CC cytokine genes clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene functions as a chemoattractant for blood monocytes, memory T helper cells and eosinophils. It causes the release of histamine from basophils and activates eosinophils. This cytokine is one of the major HIV-suppressive factors produced by CD8+ cells. It functions as one of the natural ligands for the chemokine receptor CCR5 and it suppresses in vitro replication of the R5 strains of HIV-1, which use CCR5 as a coreceptor. [provided by RefSeq, Jul 2008].
More information related to gene CCL5.
Products related to CCL5 Gene:
158 Products
Data Quality
  • 1
Type
  • 149
  • 9
Species
  • 58
  • 43
  • 43
  • 12
  • 2
Application
  • 102
  • 28
  • 27
  • 18
  • 3
Fusion tag
  • 53
  • 17
  • 16
  • 11
  • 11
Vector Backbone
  • 8
  • 6
  • 6
  • 6
  • 6
Vector
  • 77
  • 38
  • 12
  • 9
  • 5
Insert
  • 70
  • 40
  • 21
  • 10
  • 6
Oligo-Type
  • 6
  • 3
Resistance Gene
  • 77
  • 47
  • 20
  • 5
  • 2
Expression Type
  • 95
  • 54
  • 44
Selectable Marker
  • 44
  • 28
  • 27
  • 1
Promoter
  • 57
  • 33
  • 33
  • 14
  • 10
Format
  • 91
  • 27
  • 24
  • 16

Type:
ORF
Application:
Protein Expression
Gene:
Chemokine (C-C Motif) Ligand 5 (CCL5)
NCBI Accession:
NM_002985,NP_002976
Species:
Human
Synonyms:
LOC100230935, CCL5, Ccl5
Insert length:
276 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5380885
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Chemokine (C-C Motif) Ligand 5 (CCL5)
Gene ID:
327712 (Cow (Bovine), CCL5)
Synonyms:
LOC100230935, CCL5, Ccl5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3840930
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Chemokine (C-C Motif) Ligand 5 (CCL5)
Gene ID:
6352 (Human, CCL5)
Synonyms:
LOC100230935, CCL5, Ccl5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3464851
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Chemokine (C-C Motif) Ligand 5 (CCL5)
Gene ID:
81780 (Rat (Rattus), CCL5)
Synonyms:
LOC100230935, CCL5, Ccl5
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4039226
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Chemokine (C-C Motif) Ligand 5 (CCL5)
Gene ID:
20304 (Mouse (Murine), CCL5)
Synonyms:
LOC100230935, CCL5, Ccl5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4217212
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Chemokine (C-C Motif) Ligand 5 (CCL5)
NCBI Accession:
NM_013653
Species:
Mouse (Murine)
Synonyms:
LOC100230935, CCL5, Ccl5
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558171
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Chemokine (C-C Motif) Ligand 5 (CCL5)
NCBI Accession:
NM_001003010
Species:
Dog (Canine)
Synonyms:
LOC100230935, CCL5, Ccl5
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558169
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Chemokine (C-C Motif) Ligand 5 (CCL5)
NCBI Accession:
NM_002985
Species:
Human
Synonyms:
LOC100230935, CCL5, Ccl5
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558170
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Chemokine (C-C Motif) Ligand 5 (CCL5)
NCBI Accession:
NM_031116
Species:
Rat (Rattus)
Synonyms:
LOC100230935, CCL5, Ccl5
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558172
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Chemokine (C-C Motif) Ligand 5
Species:
Human
Synonyms:
Rantes, Scya5, D17S136E, RANTES, SCYA5, SIS-delta, SISd, TCP228, eoCP, MuRantes
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189119
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Chemokine (C-C Motif) Ligand 5
Species:
Mouse (Murine)
Synonyms:
Rantes, Scya5, D17S136E, RANTES, SCYA5, SIS-delta, SISd, TCP228, eoCP, MuRantes
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193578
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Chemokine (C-C Motif) Ligand 5
Species:
Rat (Rattus)
Synonyms:
Rantes, Scya5, D17S136E, RANTES, SCYA5, SIS-delta, SISd, TCP228, eoCP, MuRantes
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196202
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
ORF
Application:
Cloning
Gene:
Chemokine (C-C Motif) Ligand 5 (CCL5)
Species:
Human
Synonyms:
LOC100230935, CCL5, Ccl5
Insert length:
276 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5734200
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Cloning
Gene:
Chemokine (C-C Motif) Ligand 5 (CCL5)
NCBI Accession:
NM_013653
Species:
Mouse (Murine)
Synonyms:
LOC100230935, CCL5, Ccl5
Insert length:
276 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5734201
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Chemokine (C-C Motif) Ligand 5 (CCL5)
Gene ID:
327712 (Cow (Bovine), CCL5)
Synonyms:
LOC100230935, CCL5, Ccl5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3840931
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Chemokine (C-C Motif) Ligand 5 (CCL5)
Gene ID:
6352 (Human, CCL5)
Synonyms:
LOC100230935, CCL5, Ccl5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3464849
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Chemokine (C-C Motif) Ligand 5 (CCL5)
Gene ID:
81780 (Rat (Rattus), CCL5)
Synonyms:
LOC100230935, CCL5, Ccl5
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4039227
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Chemokine (C-C Motif) Ligand 5 (CCL5)
Gene ID:
20304 (Mouse (Murine), CCL5)
Synonyms:
LOC100230935, CCL5, Ccl5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4217211
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Chemokine (C-C Motif) Ligand 5 (CCL5)
Gene ID:
6352 (Human, CCL5)
Synonyms:
LOC100230935, CCL5, Ccl5
Insert length:
276 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5311581
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Chemokine (C-C Motif) Ligand 5 (CCL5)
NCBI Accession:
NM_001278736,NP_001265665
Species:
Human
Synonyms:
LOC100230935, CCL5, Ccl5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948182

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3376496
$300.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to CCL5

  • C-C motif chemokine 5-like (LOC100230935)
  • C-C motif chemokine ligand 5 (CCL5)
  • C-C motif chemokine ligand 5 (Ccl5)
  • chemokine (C-C motif) ligand 5 (Ccl5)
  • chemokine (C-C motif) ligand 5 (CCL5)
  • D17S136E
  • eoCP
  • MuRantes
  • Rantes
  • RANTES
  • Scya5
  • SCYA5
  • SIS-delta
  • SISd
  • TCP228

Gene-IDs for different species

GENE IDSPECIES
100230935 Taeniopygia guttata
747004 Pan troglodytes
81780 Rattus norvegicus
6352 Homo sapiens
20304 Mus musculus
417465 Gallus gallus
403522 Canis lupus familiaris
396613 Sus scrofa
327712 Bos taurus
100135495 Cavia porcellus
493689 Felis catus
100033925 Equus caballus
101115553 Ovis aries
574178 Macaca mulatta

Protein level used designations for CCL5

  • chemokine (C-C motif) ligand 5
  • small inducible cytokine A5
  • C-C motif chemokine 5
  • SIS-delta
  • T-cell-specific protein RANTES
  • regulated upon activation normal T-cell expressed and secreted
  • small-inducible cytokine A5
  • T-cell specific protein p288
  • beta-chemokine RANTES
  • eosinophil chemotactic cytokine
  • regulated upon activation, normally T-expressed, and presumably secreted
  • small inducible cytokine subfamily A (Cys-Cys), member 5
  • chemokine ah294
  • small inducible cytokine A5 RANTES
  • chemokine CCL5/RANTES
  • chemokine ligand 5
Other products related to CCL5 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com