CD2 (CD2 Molecule, CD2)

Short Description: CD2 is a surface antigen of the human T-lymphocyte lineage that is expressed on all peripheral blood T cells (summarized by Sewell et al., 1986 [PubMed 3490670]). It is one of the earliest T-cell markers, being present on more than 95% of thymocytes\; it is also found on some natural killer cells but not on B lymphocytes. Monoclonal antibodies directed against CD2 inhibit the formation of rosettes with sheep erythrocytes, indicating that CD2 is the erythrocyte receptor or is closely associated with it.[supplied by OMIM, Jul 2010].
More information related to gene CD2.
Products related to CD2 Gene:
150 Products
Data Quality
  • 2
Type
  • 141
  • 9
Species
  • 51
  • 43
  • 42
  • 12
  • 2
Application
  • 96
  • 28
  • 27
  • 16
  • 3
Fusion tag
  • 48
  • 17
  • 16
  • 11
  • 10
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 73
  • 35
  • 12
  • 9
  • 5
Insert
  • 66
  • 38
  • 21
  • 8
  • 6
Oligo-Type
  • 6
  • 3
Resistance Gene
  • 75
  • 44
  • 18
  • 4
  • 2
Expression Type
  • 90
  • 49
  • 44
Selectable Marker
  • 44
  • 26
  • 24
Promoter
  • 54
  • 31
  • 31
  • 13
  • 8
Format
  • 87
  • 27
  • 22
  • 14

Type:
ORF
Application:
Cloning
Gene:
CD2 Molecule (CD2)
Species:
Human
Synonyms:
CD2, Cd2
Insert length:
1056 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5721771
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD2 Molecule (CD2)
Gene ID:
914 (Human, CD2)
Synonyms:
CD2, Cd2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3471190
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD2 Molecule (CD2)
Gene ID:
497022 (Cow (Bovine), CD2)
Synonyms:
CD2, Cd2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3853716
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD2 Molecule (CD2)
Gene ID:
12481 (Mouse (Murine), CD2)
Synonyms:
CD2, Cd2
Vector type:
Cloning Vector
Vector backbone:
pSPORT1
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4096412
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD2 Molecule (CD2)
Gene ID:
497761 (Rat (Rattus), CD2)
Synonyms:
CD2, Cd2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4060276
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD2 Molecule (CD2)
NCBI Accession:
NM_001767
Species:
Human
Synonyms:
CD2, Cd2
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3886497
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD2 Molecule (CD2)
NCBI Accession:
NM_013486
Species:
Mouse (Murine)
Synonyms:
CD2, Cd2
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4103790
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD2 Molecule (CD2)
NCBI Accession:
NM_012830
Species:
Rat (Rattus)
Synonyms:
CD2, Cd2
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4104246
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD2 Molecule (CD2)
NCBI Accession:
NM_001195473
Species:
Rhesus Monkey
Synonyms:
CD2, Cd2
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4103976
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
CD2 Molecule
Species:
Rat (Rattus)
Synonyms:
CD2, LFA-2, Ly-37, Ly37, SRBC, T11, CD2R, LFA2, OX-34, OX34
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196378
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
CD2 Molecule
Species:
Mouse (Murine)
Synonyms:
CD2, LFA-2, Ly-37, Ly37, SRBC, T11, CD2R, LFA2, OX-34, OX34
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194085
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
CD2 Molecule
Species:
Human
Synonyms:
CD2, LFA-2, Ly-37, Ly37, SRBC, T11, CD2R, LFA2, OX-34, OX34
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189282
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD2 Molecule (CD2)
Gene ID:
914 (Human, CD2)
Synonyms:
CD2, Cd2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3471191
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD2 Molecule (CD2)
Gene ID:
497022 (Cow (Bovine), CD2)
Synonyms:
CD2, Cd2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3853715
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD2 Molecule (CD2)
Gene ID:
12481 (Mouse (Murine), CD2)
Synonyms:
CD2, Cd2
Vector type:
Cloning Vector
Vector backbone:
pSPORT1
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4096413
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD2 Molecule (CD2)
Gene ID:
497761 (Rat (Rattus), CD2)
Synonyms:
CD2, Cd2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4060277
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
CD2 Molecule (CD2)
Gene ID:
914 (Human, CD2)
Synonyms:
CD2, Cd2
Insert length:
1056 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5316662
$189.37
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
CD2 Molecule (CD2)
NCBI Accession:
NM_001767
Species:
Human
Synonyms:
CD2, Cd2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3970432
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
CD2 Molecule (CD2)
NCBI Accession:
NM_001767
Species:
Human
Synonyms:
CD2, Cd2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3970434
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
CD2 Molecule (CD2)
NCBI Accession:
NM_001767
Species:
Human
Synonyms:
CD2, Cd2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3970435
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to CD2

  • CD2 molecule (CD2)
  • CD2 antigen (Cd2)
  • Cd2 molecule (Cd2)
  • CD2
  • CD2R
  • LFA-2
  • LFA2
  • Ly-37
  • Ly37
  • OX-34
  • OX34
  • SRBC
  • T11

Gene-IDs for different species

GENE IDSPECIES
449512 Pan troglodytes
493790 Felis catus
677855 Macaca mulatta
768858 Gallus gallus
100126712 Papio anubis
100598578 Nomascus leucogenys
12481 Mus musculus
914 Homo sapiens
497761 Rattus norvegicus
497022 Bos taurus
101106727 Ovis aries
396662 Sus scrofa
100034205 Equus caballus
607448 Canis lupus familiaris

Protein level used designations for CD2

  • CD2 antigen (p50), sheep red blood cell receptor
  • T-cell surface antigen CD2
  • cluster of differentiation 2
  • CD2 antigen
  • CD2 molecule
  • LFA-3 receptor
  • T-cell surface antigen T11/Leu-5
  • lymphocyte antigen 37
  • erythrocyte receptor
  • lymphocyte-function antigen-2
  • rosette receptor
  • OX-34 antigen
  • OX-45 surface antigen homolog to human T lymphocyte CD2 antigen
  • T-lymphocyte surface antigen precursor CD2
Other products related to CD2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com