CD40 (CD40 Molecule, TNF Receptor Superfamily Member 5, CD40)

Short Description: The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor has been found to be essential in mediating a broad variety of immune and inflammatory responses including T cell-dependent immunoglobulin class switching, memory B cell development, and germinal center formation. AT-hook transcription factor AKNA is reported to coordinately regulate the expression of this receptor and its ligand, which may be important for homotypic cell interactions. Adaptor protein TNFR2 interacts with this receptor and serves as a mediator of the signal transduction. The interaction of this receptor and its ligand is found to be necessary for amyloid-beta-induced microglial activation, and thus is thought to be an early event in Alzheimer disease pathogenesis. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008].
More information related to gene CD40.
Products related to CD40 Gene:
191 Products
Data Quality
  • 1
  • 3
Type
  • 183
  • 8
Species
  • 69
  • 67
  • 41
  • 12
  • 2
Application
  • 127
  • 42
  • 23
  • 16
  • 3
Fusion tag
  • 56
  • 24
  • 24
  • 20
  • 12
Vector Backbone
  • 14
  • 14
  • 11
  • 6
  • 6
Vector
  • 87
  • 50
  • 24
  • 9
  • 6
Insert
  • 82
  • 67
  • 18
  • 8
  • 6
Oligo-Type
  • 5
  • 3
Resistance Gene
  • 96
  • 45
  • 34
  • 8
  • 2
Expression Type
  • 142
  • 62
  • 34
Selectable Marker
  • 44
  • 34
  • 24
  • 1
Promoter
  • 63
  • 53
  • 30
  • 25
  • 8
Format
  • 93
  • 54
  • 29
  • 15

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD40 Molecule, TNF Receptor Superfamily Member 5 (CD40)
Gene ID:
286849 (Cow (Bovine), CD40)
Synonyms:
CD40, Cd40
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3840241
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD40 Molecule, TNF Receptor Superfamily Member 5 (CD40)
Gene ID:
171369 (Rat (Rattus), CD40)
Synonyms:
CD40, Cd40
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048344
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD40 Molecule, TNF Receptor Superfamily Member 5 (CD40)
Gene ID:
958 (Human, CD40)
Synonyms:
CD40, Cd40
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3471228
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD40 Molecule, TNF Receptor Superfamily Member 5 (CD40)
Gene ID:
958 (Human, CD40)
Synonyms:
CD40, Cd40
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3471232
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD40 Molecule, TNF Receptor Superfamily Member 5 (CD40)
NCBI Accession:
XM_001104333
Species:
Rhesus Monkey
Synonyms:
CD40, Cd40
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4103984
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD40 Molecule, TNF Receptor Superfamily Member 5 (CD40)
NCBI Accession:
NM_001250
Species:
Human
Synonyms:
CD40, Cd40
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4103796
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CD40 Molecule, TNF Receptor Superfamily Member 5 (CD40)
NCBI Accession:
NM_134360
Species:
Rat (Rattus)
Synonyms:
CD40, Cd40
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4104250
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
CD40 Molecule, TNF Receptor Superfamily Member 5
NCBI Accession:
NM_001250, NM_152854
Species:
Human
Synonyms:
Bp50, CDW40, TNFRSF5, p50, AI326936, GP39, HIGM1, IGM, IMD3, T-BAM, TRAP, Tnfrsf5, TNFSF5
PCR Size:
121 bp
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188432
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
CD40 Molecule, TNF Receptor Superfamily Member 5
Species:
Rat (Rattus)
Synonyms:
Bp50, CDW40, TNFRSF5, p50, AI326936, GP39, HIGM1, IGM, IMD3, T-BAM, TRAP, Tnfrsf5, TNFSF5
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196335
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
CD40 Molecule, TNF Receptor Superfamily Member 5
Species:
Mouse (Murine)
Synonyms:
Bp50, CDW40, TNFRSF5, p50, AI326936, GP39, HIGM1, IGM, IMD3, T-BAM, TRAP, Tnfrsf5, TNFSF5
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193903
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
ORF
Application:
Cloning
Gene:
CD40 Molecule, TNF Receptor Superfamily Member 5 (CD40)
Species:
Human
Synonyms:
CD40, Cd40
Insert length:
834 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5749535
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD40 Molecule, TNF Receptor Superfamily Member 5 (CD40)
Gene ID:
286849 (Cow (Bovine), CD40)
Synonyms:
CD40, Cd40
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3840242
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD40 Molecule, TNF Receptor Superfamily Member 5 (CD40)
Gene ID:
171369 (Rat (Rattus), CD40)
Synonyms:
CD40, Cd40
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048345
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD40 Molecule, TNF Receptor Superfamily Member 5 (CD40)
Gene ID:
958 (Human, CD40)
Synonyms:
CD40, Cd40
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3471227
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CD40 Molecule, TNF Receptor Superfamily Member 5 (CD40)
Gene ID:
958 (Human, CD40)
Synonyms:
CD40, Cd40
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3471231
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
CD40 Molecule, TNF Receptor Superfamily Member 5 (CD40)
Gene ID:
958 (Human, CD40)
Synonyms:
CD40, Cd40
Insert length:
834 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5316008
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
CD40 Molecule, TNF Receptor Superfamily Member 5 (CD40)
NCBI Accession:
NM_001250
Gene ID:
958 (Human, CD40)
Synonyms:
CD40, Cd40
Insert length:
834 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4940827
$199.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
CD40 Molecule, TNF Receptor Superfamily Member 5 (CD40)
NCBI Accession:
NM_152854
Gene ID:
958 (Human, CD40)
Synonyms:
CD40, Cd40
Insert length:
612 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4940828
$199.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
CD40 Molecule, TNF Receptor Superfamily Member 5 (CD40)
NCBI Accession:
NM_001302753
Gene ID:
958 (Human, CD40)
Synonyms:
CD40, Cd40
Insert length:
714 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4931721
$199.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
CD40 Molecule, TNF Receptor Superfamily Member 5 (CD40)
NCBI Accession:
XM_001104333
Species:
Rhesus Monkey
Synonyms:
CD40, Cd40
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-untagged
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948161

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3926398
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
  • <
  • 1

Synonyms and alternative names related to CD40

  • CD40 molecule (CD40)
  • CD40 antigen (Cd40)
  • CD40 molecule (Cd40)
  • AI326936
  • Bp50
  • CDW40
  • GP39
  • HIGM1
  • IGM
  • IMD3
  • p50
  • T-BAM
  • TNFRSF5
  • Tnfrsf5
  • TNFSF5
  • TRAP

Gene-IDs for different species

GENE IDSPECIES
958 Homo sapiens
403469 Canis lupus familiaris
21939 Mus musculus
395385 Gallus gallus
397395 Sus scrofa
171369 Rattus norvegicus
100034049 Equus caballus
286849 Bos taurus
100349106 Oryctolagus cuniculus
100385800 Callithrix jacchus
100728791 Cavia porcellus
443232 Ovis aries
707749 Macaca mulatta

Protein level used designations for CD40

  • B cell surface antigen CD40
  • B cell-associated molecule
  • B-cell surface antigen CD40
  • CD40 antigen (TNF receptor superfamily member 5)
  • CD40 type II isoform
  • CD40L receptor
  • nerve growth factor receptor-related B-lymphocyte activation molecule
  • tumor necrosis factor receptor superfamily member 5
  • tumor necrosis factor receptor superfamily, member 5
  • T-cell differentiation antigen
  • human CD40-homologue
  • CD40 antigen, TNF receptor superfamily member 5
Other products related to CD40 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com