CD74 (HLA-DR-gamma, CD74)

Short Description: The protein encoded by this gene associates with class II major histocompatibility complex (MHC) and is an important chaperone that regulates antigen presentation for immune response. It also serves as cell surface receptor for the cytokine macrophage migration inhibitory factor (MIF) which, when bound to the encoded protein, initiates survival pathways and cell proliferation. This protein also interacts with amyloid precursor protein (APP) and suppresses the production of amyloid beta (Abeta). Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011].
More information related to gene CD74.
Products related to CD74 Gene:
192 Products
Type
  • 185
  • 7
Species
  • 68
  • 57
  • 31
  • 12
  • 12
Application
  • 128
  • 48
  • 26
  • 16
  • 2
Fusion tag
  • 65
  • 23
  • 20
  • 17
  • 12
Vector Backbone
  • 11
  • 11
  • 7
  • 6
  • 6
Vector
  • 95
  • 46
  • 16
  • 11
  • 9
Insert
  • 85
  • 63
  • 21
  • 8
  • 6
Oligo-Type
  • 5
  • 2
Resistance Gene
  • 85
  • 60
  • 34
  • 6
  • 2
Expression Type
  • 126
  • 60
  • 44
Selectable Marker
  • 44
  • 34
  • 26
  • 1
Promoter
  • 61
  • 51
  • 31
  • 17
  • 8
Format
  • 100
  • 36
  • 30
  • 26

Type:
ORF
Application:
Cloning
Gene:
HLA-DR-gamma (CD74)
Species:
Human
Synonyms:
CD74, Cd74, cd74a
Insert length:
699 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5727597
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
HLA-DR-gamma (CD74)
NCBI Accession:
NM_001025158,NP_001020329
Species:
Human
Synonyms:
CD74, Cd74, cd74a
Insert length:
483 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5359618
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
HLA-DR-gamma (CD74)
NCBI Accession:
NM_001025158
Gene ID:
972 (Human, CD74)
Synonyms:
CD74, Cd74, cd74a
Insert length:
483 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4940803
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
HLA-DR-gamma (CD74)
Gene ID:
58113 (Zebrafish (Danio rerio), CD74)
Synonyms:
CD74, Cd74, cd74a
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4046645
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
HLA-DR-gamma (CD74)
Gene ID:
30645 (Zebrafish (Danio rerio), CD74)
Synonyms:
CD74, Cd74, cd74a
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4071594
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
HLA-DR-gamma (CD74)
Gene ID:
30645 (Zebrafish (Danio rerio), CD74)
Synonyms:
CD74, Cd74, cd74a
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4071595
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
HLA-DR-gamma (CD74)
Gene ID:
30645 (Zebrafish (Danio rerio), CD74)
Synonyms:
CD74, Cd74, cd74a
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4071596
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
HLA-DR-gamma (CD74)
Gene ID:
30645 (Zebrafish (Danio rerio), CD74)
Synonyms:
CD74, Cd74, cd74a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3875762
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
HLA-DR-gamma (CD74)
Gene ID:
16149 (Mouse (Murine), CD74)
Synonyms:
CD74, Cd74, cd74a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4215553
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
HLA-DR-gamma (CD74)
Gene ID:
16149 (Mouse (Murine), CD74)
Synonyms:
CD74, Cd74, cd74a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4215555
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
HLA-DR-gamma (CD74)
Gene ID:
972 (Human, CD74)
Synonyms:
CD74, Cd74, cd74a
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083600
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
HLA-DR-gamma (CD74)
Gene ID:
972 (Human, CD74)
Synonyms:
CD74, Cd74, cd74a
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083599
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
HLA-DR-gamma (CD74)
Gene ID:
613384 (Cow (Bovine), CD74)
Synonyms:
CD74, Cd74, cd74a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3865538
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
HLA-DR-gamma (CD74)
Gene ID:
25599 (Rat (Rattus), CD74)
Synonyms:
CD74, Cd74, cd74a
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4036928
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
HLA-DR-gamma (CD74)
NCBI Accession:
NM_004355
Species:
Human
Synonyms:
CD74, Cd74, cd74a
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4103801
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
HLA-DR-gamma (CD74)
NCBI Accession:
XM_005558265
Species:
Cynomolgus
Synonyms:
CD74, Cd74, cd74a
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4103988
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
cDNA
Application:
Cloning
Gene:
HLA-DR-gamma (CD74)
NCBI Accession:
XM_004801653
Species:
Ferret
Synonyms:
CD74, Cd74, cd74a
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4103989
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
HLA-DR-gamma (CD74)
NCBI Accession:
NM_001042605
Species:
Mouse (Murine)
Synonyms:
CD74, Cd74, cd74a
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4104254
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
HLA-DR-gamma (CD74)
NCBI Accession:
NM_013069
Species:
Rat (Rattus)
Synonyms:
CD74, Cd74, cd74a
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558306
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
HLA-DR-gamma
Species:
Mouse (Murine)
Synonyms:
DHLAG, HLADG, II, Ia-GAMMA, CLIP, Ii, INVG34, Iclp-1, iclp1, wu:fb11f09, wu:fb12a01, wu:fb13d06, wu:fk94e07
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194269
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
  • <
  • 1

Synonyms and alternative names related to CD74

  • CD74 molecule (CD74)
  • CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated) (Cd74)
  • CD74 molecule (Cd74)
  • CD74 molecule, major histocompatibility complex, class II invariant chain a (cd74a)
  • CLIP
  • DHLAG
  • HLADG
  • Ia-GAMMA
  • Iclp-1
  • iclp1
  • II
  • Ii
  • INVG34
  • wu:fb11f09
  • wu:fb12a01
  • wu:fb13d06
  • wu:fk94e07

Gene-IDs for different species

GENE IDSPECIES
972 Homo sapiens
16149 Mus musculus
25599 Rattus norvegicus
613384 Bos taurus
479329 Canis lupus familiaris
101681737 Mustela putorius furo
58113 Danio rerio

Protein level used designations for CD74

  • CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated)
  • HLA class II histocompatibility antigen gamma chain
  • HLA-DR antigens-associated invariant chain
  • HLA-DR-gamma
  • Ia-associated invariant chain
  • MHC HLA-DR gamma chain
  • gamma chain of class II antigens
  • p33
  • H-2 class II histocompatibility antigen gamma chain
  • HLA-DR-GAMMA
  • MHC class II-associated invariant chain
  • class II-associated invariant chain peptide
  • dinucleotide microsatellite
  • histocompatibility: class II antigens, gamma chain of
  • ia antigen-associated invariant chain
  • invariant polypeptide of major histocompatibility complex, class II antigen-associated
  • ii
  • CD74 molecule, major histocompatibility complex, class II invariant chain
  • CD74 molecule, major histocompatibility complex, class II invariant chain a
  • MHC II
  • invariant chain-like protein 1
Other products related to CD74 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com