CDO1 (Cysteine Dioxygenase, Type I, CDO1)

Short Description: enzyme crucial for the metabolism of cysteine [RGD, Feb 2006].
More information related to gene CDO1.
Products related to CDO1 Gene:
139 Products
Type
  • 131
  • 8
Species
  • 55
  • 44
  • 31
  • 3
  • 2
Application
  • 84
  • 34
  • 27
  • 16
  • 2
Fusion tag
  • 52
  • 16
  • 13
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 61
  • 36
  • 12
  • 9
  • 8
Insert
  • 50
  • 44
  • 21
  • 8
  • 6
Oligo-Type
  • 6
  • 2
Resistance Gene
  • 58
  • 49
  • 18
  • 6
  • 2
Expression Type
  • 95
  • 50
  • 26
Selectable Marker
  • 26
  • 26
  • 24
  • 1
Promoter
  • 43
  • 31
  • 31
  • 13
  • 8
Format
  • 67
  • 27
  • 23
  • 22

Type:
ORF
Application:
Protein Expression
Gene:
Cysteine Dioxygenase, Type I (CDO1)
NCBI Accession:
NM_001801,NP_001792
Species:
Human
Synonyms:
NAEGRDRAFT_80458, Cdo1, CDO1
Insert length:
603 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5440526
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Cysteine Dioxygenase, Type I (CDO1)
NCBI Accession:
NM_001801
Gene ID:
1036 (Human, CDO1)
Synonyms:
NAEGRDRAFT_80458, Cdo1, CDO1
Insert length:
603 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4940715
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cysteine Dioxygenase, Type I (CDO1)
Gene ID:
393714 (Zebrafish (Danio rerio), CDO1)
Synonyms:
NAEGRDRAFT_80458, Cdo1, CDO1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4056646
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cysteine Dioxygenase, Type I (CDO1)
Gene ID:
393714 (Zebrafish (Danio rerio), CDO1)
Synonyms:
NAEGRDRAFT_80458, Cdo1, CDO1
Vector type:
Cloning Vector
Vector backbone:
pBluescript SK-
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3468588
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cysteine Dioxygenase, Type I (CDO1)
Gene ID:
398963 (Xenopus laevis, CDO1)
Synonyms:
NAEGRDRAFT_80458, Cdo1, CDO1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3846355
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cysteine Dioxygenase, Type I (CDO1)
Gene ID:
514462 (Cow (Bovine), CDO1)
Synonyms:
NAEGRDRAFT_80458, Cdo1, CDO1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3858853
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cysteine Dioxygenase, Type I (CDO1)
Gene ID:
394737 (Xenopus tropicalis, CDO1)
Synonyms:
NAEGRDRAFT_80458, Cdo1, CDO1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3881782
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cysteine Dioxygenase, Type I (CDO1)
Gene ID:
12583 (Mouse (Murine), CDO1)
Synonyms:
NAEGRDRAFT_80458, Cdo1, CDO1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3463152
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cysteine Dioxygenase, Type I (CDO1)
Gene ID:
81718 (Rat (Rattus), CDO1)
Synonyms:
NAEGRDRAFT_80458, Cdo1, CDO1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4047374
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cysteine Dioxygenase, Type I (CDO1)
Gene ID:
1036 (Human, CDO1)
Synonyms:
NAEGRDRAFT_80458, Cdo1, CDO1
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3469078
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cysteine Dioxygenase, Type I (CDO1)
NCBI Accession:
NM_033037
Species:
Mouse (Murine)
Synonyms:
NAEGRDRAFT_80458, Cdo1, CDO1
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3886561
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cysteine Dioxygenase, Type I (CDO1)
Species:
Human
Synonyms:
NAEGRDRAFT_80458, Cdo1, CDO1
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558407
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cysteine Dioxygenase, Type I (CDO1)
NCBI Accession:
NM_052809
Species:
Rat (Rattus)
Synonyms:
NAEGRDRAFT_80458, Cdo1, CDO1
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558408
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Cysteine Dioxygenase, Type I
Species:
Human
Synonyms:
1300002L19Rik, Cdo, D18Ucla3
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3191953
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Cysteine Dioxygenase, Type I
Species:
Mouse (Murine)
Synonyms:
1300002L19Rik, Cdo, D18Ucla3
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3195596
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cysteine Dioxygenase, Type I (CDO1)
Gene ID:
393714 (Zebrafish (Danio rerio), CDO1)
Synonyms:
NAEGRDRAFT_80458, Cdo1, CDO1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4056647
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Cysteine Dioxygenase, Type I (CDO1)
Species:
Human
Synonyms:
NAEGRDRAFT_80458, Cdo1, CDO1
Insert length:
603 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5752417
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cysteine Dioxygenase, Type I (CDO1)
Gene ID:
398963 (Xenopus laevis, CDO1)
Synonyms:
NAEGRDRAFT_80458, Cdo1, CDO1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3846356
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cysteine Dioxygenase, Type I (CDO1)
Gene ID:
514462 (Cow (Bovine), CDO1)
Synonyms:
NAEGRDRAFT_80458, Cdo1, CDO1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3858854
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cysteine Dioxygenase, Type I (CDO1)
Gene ID:
394737 (Xenopus tropicalis, CDO1)
Synonyms:
NAEGRDRAFT_80458, Cdo1, CDO1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3881783
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to CDO1

  • cysteine dioxygenase, type I (NAEGRDRAFT_80458)
  • cysteine dioxygenase 1, cytosolic (Cdo1)
  • cysteine dioxygenase type 1 (CDO1)
  • cysteine dioxygenase type 1 (Cdo1)
  • 1300002L19Rik
  • Cdo
  • D18Ucla3

Gene-IDs for different species

GENE IDSPECIES
8851968 Naegleria gruberi strain NEG-M
12583 Mus musculus
1036 Homo sapiens
81718 Rattus norvegicus
427391 Gallus gallus
474637 Canis lupus familiaris
514462 Bos taurus
100174398 Pongo abelii

Protein level used designations for CDO1

  • cysteine dioxygenase, type I
  • CDO-I
  • cysteine dioxygenase type 1
  • cysteine dioxygenase type I
  • cytosolic cysteine dioxygenase 1
  • CDO
  • cysteine dioxygenase 1, cytosolic
Other products related to CDO1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com