CNTF Receptor alpha (Ciliary Neurotrophic Factor Receptor, CNTFR)

Short Description: This gene encodes a member of the type 1 cytokine receptor family. The encoded protein is the ligand-specific component of a tripartite receptor for ciliary neurotrophic factor, which plays a critical role in neuronal cell survival, differentiation and gene expression. Binding of ciliary neurotrophic factor to the encoded protein recruits the transmembrane components of the receptor, gp130 and leukemia inhibitory factor receptor, facilitating signal transduction. Single nucleotide polymorphisms in this gene may be associated with variations in muscle strength, as well as early onset of eating disorders. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2011].
More information related to gene CNTF Receptor alpha.
Products related to CNTF Receptor alpha Gene:
173 Products
Type
  • 165
  • 8
Species
  • 68
  • 62
  • 39
  • 2
  • 2
Application
  • 110
  • 38
  • 25
  • 16
  • 2
Fusion tag
  • 50
  • 24
  • 21
  • 18
  • 11
Vector Backbone
  • 12
  • 12
  • 6
  • 6
  • 5
Vector
  • 75
  • 46
  • 20
  • 9
  • 9
Insert
  • 75
  • 55
  • 19
  • 8
  • 6
Oligo-Type
  • 6
  • 2
Resistance Gene
  • 83
  • 43
  • 32
  • 7
  • 2
Expression Type
  • 122
  • 58
  • 33
Selectable Marker
  • 34
  • 33
  • 24
  • 1
Promoter
  • 55
  • 45
  • 31
  • 22
  • 8
Format
  • 84
  • 45
  • 27
  • 17

Type:
ORF
Application:
Cloning
Gene:
Ciliary Neurotrophic Factor Receptor (CNTFR)
Species:
Human
Synonyms:
CNTFR, cntfr.L, Cntfr, cntfr
Insert length:
1119 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5771740
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Ciliary Neurotrophic Factor Receptor (CNTFR)
NCBI Accession:
NM_147164,NP_671693
Species:
Human
Synonyms:
CNTFR, cntfr.L, Cntfr, cntfr
Insert length:
1119 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5498288
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ciliary Neurotrophic Factor Receptor (CNTFR)
Gene ID:
1271 (Human, CNTFR)
Synonyms:
CNTFR, cntfr.L, Cntfr, cntfr
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083796
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ciliary Neurotrophic Factor Receptor (CNTFR)
Gene ID:
100135712 (Xenopus tropicalis, CNTFR)
Synonyms:
CNTFR, cntfr.L, Cntfr, cntfr
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3873434
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ciliary Neurotrophic Factor Receptor (CNTFR)
Gene ID:
12804 (Mouse (Murine), CNTFR)
Synonyms:
CNTFR, cntfr.L, Cntfr, cntfr
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3875260
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ciliary Neurotrophic Factor Receptor (CNTFR)
Gene ID:
380252 (Xenopus laevis, CNTFR)
Synonyms:
CNTFR, cntfr.L, Cntfr, cntfr
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3843943
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ciliary Neurotrophic Factor Receptor (CNTFR)
NCBI Accession:
NM_001003929
Species:
Rat (Rattus)
Synonyms:
CNTFR, cntfr.L, Cntfr, cntfr
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3886622
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ciliary Neurotrophic Factor Receptor (CNTFR)
NCBI Accession:
NM_001842
Species:
Human
Synonyms:
CNTFR, cntfr.L, Cntfr, cntfr
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558710
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Ciliary Neurotrophic Factor Receptor
Species:
Human
Synonyms:
CNTFR-alpha, CNTFRALPHA, Cntfralpha, cb549, fj33e02, sb:cb549, wu:fj33e02, si:bz76a6.1, si:dz248f2.1, si:rp71-76a6.1
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189309
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Ciliary Neurotrophic Factor Receptor
Species:
Rat (Rattus)
Synonyms:
CNTFR-alpha, CNTFRALPHA, Cntfralpha, cb549, fj33e02, sb:cb549, wu:fj33e02, si:bz76a6.1, si:dz248f2.1, si:rp71-76a6.1
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196183
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ciliary Neurotrophic Factor Receptor (CNTFR)
Gene ID:
1271 (Human, CNTFR)
Synonyms:
CNTFR, cntfr.L, Cntfr, cntfr
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083797
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ciliary Neurotrophic Factor Receptor (CNTFR)
Gene ID:
100135712 (Xenopus tropicalis, CNTFR)
Synonyms:
CNTFR, cntfr.L, Cntfr, cntfr
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3873435
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ciliary Neurotrophic Factor Receptor (CNTFR)
Gene ID:
12804 (Mouse (Murine), CNTFR)
Synonyms:
CNTFR, cntfr.L, Cntfr, cntfr
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3463281
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ciliary Neurotrophic Factor Receptor (CNTFR)
Gene ID:
380252 (Xenopus laevis, CNTFR)
Synonyms:
CNTFR, cntfr.L, Cntfr, cntfr
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3843944
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Ciliary Neurotrophic Factor Receptor (CNTFR)
Gene ID:
1271 (Human, CNTFR)
Synonyms:
CNTFR, cntfr.L, Cntfr, cntfr
Insert length:
1119 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5316798
$189.37
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Ciliary Neurotrophic Factor Receptor (CNTFR)
Species:
Human
Synonyms:
CNTFR, cntfr.L, Cntfr, cntfr
Insert length:
1119 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4435229
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Ciliary Neurotrophic Factor Receptor (CNTFR)
Species:
Human
Synonyms:
CNTFR, cntfr.L, Cntfr, cntfr
Insert length:
1119 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4474134
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ciliary Neurotrophic Factor Receptor (CNTFR)
Species:
Human
Synonyms:
CNTFR, cntfr.L, Cntfr, cntfr
Insert length:
1119 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4700158
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ciliary Neurotrophic Factor Receptor (CNTFR)
Species:
Human
Synonyms:
CNTFR, cntfr.L, Cntfr, cntfr
Insert length:
1119 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4829287
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ciliary Neurotrophic Factor Receptor (CNTFR)
Species:
Human
Synonyms:
CNTFR, cntfr.L, Cntfr, cntfr
Insert length:
1119 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4760509
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to CNTF Receptor alpha

  • ciliary neurotrophic factor receptor (CNTFR)
  • ciliary neurotrophic factor receptor L homeolog (cntfr.L)
  • ciliary neurotrophic factor receptor (Cntfr)
  • ciliary neurotrophic factor receptor (cntfr)
  • cb549
  • CNTFR-alpha
  • CNTFRALPHA
  • Cntfralpha
  • fj33e02
  • sb:cb549
  • si:bz76a6.1
  • si:dz248f2.1
  • si:rp71-76a6.1
  • wu:fj33e02

Gene-IDs for different species

GENE IDSPECIES
1271 Homo sapiens
380252 Xenopus laevis
442941 Canis lupus familiaris
539548 Bos taurus
700959 Macaca mulatta
313173 Rattus norvegicus
100135712 Xenopus (Silurana) tropicalis
12804 Mus musculus
395885 Gallus gallus
368438 Danio rerio
100226158 Taeniopygia guttata
100349367 Oryctolagus cuniculus
100478954 Ailuropoda melanoleuca
100581920 Nomascus leucogenys
100524518 Sus scrofa
100722634 Cavia porcellus
100885760 Ovis aries
100146590 Equus caballus

Protein level used designations for CNTF Receptor alpha

  • CNTF receptor subunit alpha
  • CNTFR-alpha
  • ciliary neurotrophic factor receptor subunit alpha
  • CNTFR alpha
  • ciliary neurotrophic factor receptor alpha
  • ciliary neurotrophic factor receptor subunit alpha preproprotein
  • GPA receptor subunit alpha
  • GPAR-alpha
  • growth promoting activity (GPA) receptor alpha; GPARalpha
  • growth-promoting activity receptor subunit alpha
  • ciliary neurotrophic factor receptor
  • ciliary neurotrophic factor receptor subunit alpha-like
Other products related to CNTF Receptor alpha such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com