Complement Factor H (Complement Factor H, CFH)

Short Description: This gene is a member of the Regulator of Complement Activation (RCA) gene cluster and encodes a protein with twenty short consensus repeat (SCR) domains. This protein is secreted into the bloodstream and has an essential role in the regulation of complement activation, restricting this innate defense mechanism to microbial infections. Mutations in this gene have been associated with hemolytic-uremic syndrome (HUS) and chronic hypocomplementemic nephropathy. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Oct 2011].
More information related to gene Complement Factor H.
Products related to Complement Factor H Gene:
145 Products
Data Quality
  • 1
Type
  • 138
  • 7
Species
  • 58
  • 42
  • 39
  • 2
  • 2
Application
  • 93
  • 31
  • 25
  • 16
  • 2
Fusion tag
  • 50
  • 15
  • 15
  • 10
  • 9
Vector Backbone
  • 6
  • 6
  • 6
  • 5
  • 5
Vector
  • 72
  • 34
  • 12
  • 9
  • 7
Insert
  • 59
  • 43
  • 20
  • 8
  • 6
Oligo-Type
  • 5
  • 2
Resistance Gene
  • 66
  • 50
  • 16
  • 6
  • 2
Expression Type
  • 95
  • 51
  • 35
Selectable Marker
  • 35
  • 26
  • 26
  • 1
Promoter
  • 52
  • 31
  • 30
  • 14
  • 8
Format
  • 79
  • 27
  • 20
  • 19

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Complement Factor H (CFH)
Gene ID:
379371 (Xenopus laevis, CFH)
Synonyms:
CFH, Cfh, cfh, LOC100399888, LOC100733902, cfh.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3842460
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Complement Factor H (CFH)
Gene ID:
3075 (Human, CFH)
Synonyms:
CFH, Cfh, cfh, LOC100399888, LOC100733902, cfh.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3804206
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Complement Factor H (CFH)
Gene ID:
394826 (Xenopus tropicalis, CFH)
Synonyms:
CFH, Cfh, cfh, LOC100399888, LOC100733902, cfh.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3881972
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Complement Factor H (CFH)
Gene ID:
155012 (Rat (Rattus), CFH)
Synonyms:
CFH, Cfh, cfh, LOC100399888, LOC100733902, cfh.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048172
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Complement Factor H (CFH)
Gene ID:
12628 (Mouse (Murine), CFH)
Synonyms:
CFH, Cfh, cfh, LOC100399888, LOC100733902, cfh.L
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4098583
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Complement Factor H (CFH)
Gene ID:
280816 (Cow (Bovine), CFH)
Synonyms:
CFH, Cfh, cfh, LOC100399888, LOC100733902, cfh.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048822
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Complement Factor H (CFH)
NCBI Accession:
NM_000186
Species:
Human
Synonyms:
CFH, Cfh, cfh, LOC100399888, LOC100733902, cfh.L
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558471
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Complement Factor H (CFH)
NCBI Accession:
NM_009888
Species:
Mouse (Murine)
Synonyms:
CFH, Cfh, cfh, LOC100399888, LOC100733902, cfh.L
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558472
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Complement Factor H (CFH)
Species:
Rat (Rattus)
Synonyms:
CFH, Cfh, cfh, LOC100399888, LOC100733902, cfh.L
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558473
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Complement Factor H
Species:
Human
Synonyms:
AHUS1, AMBP1, ARMD4, ARMS1, CFHL3, FH, FHL1, HF, HF1, HF2, HUS, Mud-1, NOM, Sas-1, Sas1, Fh, CFH, im:7147412, si:ch211-207o17.2, fH, armd4, arms1, cfh, cfhl3, fhl1, hf1, hf2, hus
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189222
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Complement Factor H
Species:
Rat (Rattus)
Synonyms:
AHUS1, AMBP1, ARMD4, ARMS1, CFHL3, FH, FHL1, HF, HF1, HF2, HUS, Mud-1, NOM, Sas-1, Sas1, Fh, CFH, im:7147412, si:ch211-207o17.2, fH, armd4, arms1, cfh, cfhl3, fhl1, hf1, hf2, hus
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3197145
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
ORF
Application:
Cloning
Gene:
Complement Factor H (CFH)
Species:
Human
Synonyms:
CFH, Cfh, cfh, LOC100399888, LOC100733902, cfh.L
Insert length:
1350 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5722665
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Complement Factor H (CFH)
Gene ID:
379371 (Xenopus laevis, CFH)
Synonyms:
CFH, Cfh, cfh, LOC100399888, LOC100733902, cfh.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3842459
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Complement Factor H (CFH)
Gene ID:
3075 (Human, CFH)
Synonyms:
CFH, Cfh, cfh, LOC100399888, LOC100733902, cfh.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3804207
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Complement Factor H (CFH)
Gene ID:
394826 (Xenopus tropicalis, CFH)
Synonyms:
CFH, Cfh, cfh, LOC100399888, LOC100733902, cfh.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3881973
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Complement Factor H (CFH)
Gene ID:
155012 (Rat (Rattus), CFH)
Synonyms:
CFH, Cfh, cfh, LOC100399888, LOC100733902, cfh.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048171
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Complement Factor H (CFH)
Gene ID:
12628 (Mouse (Murine), CFH)
Synonyms:
CFH, Cfh, cfh, LOC100399888, LOC100733902, cfh.L
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4098582
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Complement Factor H (CFH)
Gene ID:
280816 (Cow (Bovine), CFH)
Synonyms:
CFH, Cfh, cfh, LOC100399888, LOC100733902, cfh.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048821
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Complement Factor H (CFH)
Gene ID:
3075 (Human, CFH)
Synonyms:
CFH, Cfh, cfh, LOC100399888, LOC100733902, cfh.L
Insert length:
1350 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5317255
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Complement Factor H (CFH)
Species:
Rat (Rattus)
Synonyms:
CFH, Cfh, cfh, LOC100399888, LOC100733902, cfh.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948168

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3974099
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to Complement Factor H

  • complement factor H (CFH)
  • complement component factor h (Cfh)
  • complement factor H (Cfh)
  • complement factor H (cfh)
  • complement factor H-related protein 5 (LOC100399888)
  • complement factor H (LOC100733902)
  • complement factor H L homeolog (cfh.L)
  • AHUS1
  • AMBP1
  • ARMD4
  • armd4
  • ARMS1
  • arms1
  • cfh
  • CFH
  • cfhl3
  • CFHL3
  • Fh
  • fH
  • FH
  • fhl1
  • FHL1
  • HF
  • hf1
  • HF1
  • HF2
  • hf2
  • hus
  • HUS
  • im:7147412
  • Mud-1
  • NOM
  • Sas-1
  • Sas1
  • si:ch211-207o17.2

Gene-IDs for different species

GENE IDSPECIES
3075 Homo sapiens
397525 Sus scrofa
12628 Mus musculus
155012 Rattus norvegicus
280816 Bos taurus
429057 Gallus gallus
457601 Pan troglodytes
478952 Canis lupus familiaris
553297 Danio rerio
100051358 Equus caballus
100174982 Ovis aries
100340175 Oryctolagus cuniculus
100399888 Callithrix jacchus
100451270 Pongo abelii
100465619 Ailuropoda melanoleuca
100600041 Nomascus leucogenys
100733902 Cavia porcellus
379371 Xenopus laevis

Protein level used designations for Complement Factor H

  • H factor 1 (complement)
  • H factor 2 (complement)
  • adrenomedullin binding protein
  • age-related maculopathy susceptibility 1
  • beta-1-H-globulin
  • beta-1H
  • factor H
  • factor H-like 1
  • complement regulator factor H
  • complement factor H
  • complement factor H related protein 3A4/5G4
  • protein beta-1-H
  • complement component factor H
  • complement inhibitory factor H
  • platelet complement factor H
  • complement factor H L homeolog
Other products related to Complement Factor H such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com