COX7B (Cytochrome C Oxidase Subunit VIIb, COX7B)

Short Description: Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes subunit VIIb, which is highly similar to bovine COX VIIb protein and is found in all tissues. This gene may have several pseudogenes on chromosomes 1, 2, 20 and 22. [provided by RefSeq, Jun 2011].
More information related to gene COX7B.
Products related to COX7B Gene:
124 Products
Type
  • 117
  • 7
Species
  • 46
  • 40
  • 28
  • 4
  • 2
Application
  • 71
  • 35
  • 25
  • 16
  • 1
Fusion tag
  • 51
  • 16
  • 11
  • 10
  • 6
Vector Backbone
  • 8
  • 6
  • 6
  • 6
  • 6
Vector
  • 48
  • 34
  • 12
  • 10
  • 9
Insert
  • 45
  • 37
  • 19
  • 8
  • 6
Oligo-Type
  • 6
  • 1
Resistance Gene
  • 47
  • 45
  • 20
  • 5
  • 2
Expression Type
  • 93
  • 48
  • 13
  • 2
Selectable Marker
  • 28
  • 24
  • 13
  • 1
Promoter
  • 31
  • 31
  • 30
  • 13
  • 8
Format
  • 51
  • 27
  • 25
  • 21

Type:
ORF
Application:
Cloning
Gene:
Cytochrome C Oxidase Subunit VIIb (COX7B)
Species:
Human
Synonyms:
COX7B, Cox7b, cox7b.L, cox7b
Insert length:
243 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5744540
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Cytochrome C Oxidase Subunit VIIb (COX7B)
NCBI Accession:
NM_001866,NP_001857
Species:
Human
Synonyms:
COX7B, Cox7b, cox7b.L, cox7b
Insert length:
243 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5414878
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cytochrome C Oxidase Subunit VIIb (COX7B)
Gene ID:
563476 (Zebrafish (Danio rerio), COX7B)
Synonyms:
COX7B, Cox7b, cox7b.L, cox7b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4023422
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cytochrome C Oxidase Subunit VIIb (COX7B)
Gene ID:
563476 (Zebrafish (Danio rerio), COX7B)
Synonyms:
COX7B, Cox7b, cox7b.L, cox7b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4023421
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cytochrome C Oxidase Subunit VIIb (COX7B)
Gene ID:
303393 (Rat (Rattus), COX7B)
Synonyms:
COX7B, Cox7b, cox7b.L, cox7b
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4051933
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cytochrome C Oxidase Subunit VIIb (COX7B)
Gene ID:
66142 (Mouse (Murine), COX7B)
Synonyms:
COX7B, Cox7b, cox7b.L, cox7b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3819696
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cytochrome C Oxidase Subunit VIIb (COX7B)
Gene ID:
447278 (Xenopus laevis, COX7B)
Synonyms:
COX7B, Cox7b, cox7b.L, cox7b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3852089
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cytochrome C Oxidase Subunit VIIb (COX7B)
Gene ID:
100300550 (Cow (Bovine), COX7B)
Synonyms:
COX7B, Cox7b, cox7b.L, cox7b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3874878
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cytochrome C Oxidase Subunit VIIb (COX7B)
Gene ID:
66142 (Mouse (Murine), COX7B)
Synonyms:
COX7B, Cox7b, cox7b.L, cox7b
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4038374
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cytochrome C Oxidase Subunit VIIb (COX7B)
Gene ID:
1349 (Human, COX7B)
Synonyms:
COX7B, Cox7b, cox7b.L, cox7b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3471373
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cytochrome C Oxidase Subunit VIIb (COX7B)
NCBI Accession:
NM_025379
Species:
Mouse (Murine)
Synonyms:
COX7B, Cox7b, cox7b.L, cox7b
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558805
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Cytochrome C Oxidase Subunit VIIb
Species:
Mouse (Murine)
Synonyms:
APLCC, 1100001F07Rik, 1110004F07Rik, C80563, MGC86432, MGC147245, fk47c09, wu:fk47c09, zgc:194876, IHQ
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194706
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cytochrome C Oxidase Subunit VIIb (COX7B)
Gene ID:
563476 (Zebrafish (Danio rerio), COX7B)
Synonyms:
COX7B, Cox7b, cox7b.L, cox7b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4023423
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cytochrome C Oxidase Subunit VIIb (COX7B)
Gene ID:
563476 (Zebrafish (Danio rerio), COX7B)
Synonyms:
COX7B, Cox7b, cox7b.L, cox7b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4023424
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cytochrome C Oxidase Subunit VIIb (COX7B)
Gene ID:
303393 (Rat (Rattus), COX7B)
Synonyms:
COX7B, Cox7b, cox7b.L, cox7b
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4051934
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cytochrome C Oxidase Subunit VIIb (COX7B)
Gene ID:
66142 (Mouse (Murine), COX7B)
Synonyms:
COX7B, Cox7b, cox7b.L, cox7b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3819694
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cytochrome C Oxidase Subunit VIIb (COX7B)
Gene ID:
447278 (Xenopus laevis, COX7B)
Synonyms:
COX7B, Cox7b, cox7b.L, cox7b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3852088
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cytochrome C Oxidase Subunit VIIb (COX7B)
Gene ID:
100300550 (Cow (Bovine), COX7B)
Synonyms:
COX7B, Cox7b, cox7b.L, cox7b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3874880
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cytochrome C Oxidase Subunit VIIb (COX7B)
Gene ID:
66142 (Mouse (Murine), COX7B)
Synonyms:
COX7B, Cox7b, cox7b.L, cox7b
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4038373
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cytochrome C Oxidase Subunit VIIb (COX7B)
Gene ID:
1349 (Human, COX7B)
Synonyms:
COX7B, Cox7b, cox7b.L, cox7b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3471374
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to COX7B

  • cytochrome c oxidase subunit 7B (COX7B)
  • cytochrome c oxidase subunit VIIb (Cox7b)
  • cytochrome c oxidase subunit 7B (Cox7b)
  • cytochrome c oxidase subunit VIIb L homeolog (cox7b.L)
  • cytochrome c oxidase subunit VIIb (cox7b)
  • cytochrome c oxidase subunit VIIb (COX7B)
  • 1100001F07Rik
  • 1110004F07Rik
  • APLCC
  • C80563
  • fk47c09
  • IHQ
  • MGC86432
  • MGC147245
  • wu:fk47c09
  • zgc:194876

Gene-IDs for different species

GENE IDSPECIES
1349 Homo sapiens
66142 Mus musculus
303393 Rattus norvegicus
447278 Xenopus laevis
779702 Xenopus (Silurana) tropicalis
100172849 Pongo abelii
563476 Danio rerio
100219756 Taeniopygia guttata
100300550 Bos taurus

Protein level used designations for COX7B

  • cytochrome c oxidase polypeptide VIIb
  • cytochrome c oxidase subunit 7B, mitochondrial
  • cytochrome-c oxidase chain VIIb
  • cytochrome c oxidase subunit VIIb
  • Cytochrome c oxidase polypeptide VIIb, mitochondrial
Other products related to COX7B such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com