CREB1 (cAMP Responsive Element Binding Protein 1, CREB1)

Short Description: This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds as a homodimer to the cAMP-responsive element, an octameric palindrome. The protein is phosphorylated by several protein kinases, and induces transcription of genes in response to hormonal stimulation of the cAMP pathway. Alternate splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008].
More information related to gene CREB1.
Products related to CREB1 Gene:
183 Products
Data Quality
  • 3
  • 3
Type
  • 177
  • 6
Species
  • 73
  • 63
  • 40
  • 2
  • 2
Application
  • 119
  • 46
  • 23
  • 16
  • 2
Fusion tag
  • 56
  • 24
  • 22
  • 19
  • 10
Vector Backbone
  • 13
  • 13
  • 9
  • 8
  • 6
Vector
  • 82
  • 48
  • 24
  • 9
  • 8
Insert
  • 71
  • 71
  • 19
  • 8
  • 6
Oligo-Type
  • 4
  • 2
Resistance Gene
  • 89
  • 48
  • 32
  • 8
  • 2
Expression Type
  • 143
  • 63
  • 26
Selectable Marker
  • 43
  • 26
  • 24
  • 1
Promoter
  • 61
  • 47
  • 31
  • 26
  • 8
Format
  • 82
  • 54
  • 27
  • 20

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CAMP Responsive Element Binding Protein 1 (CREB1)
Gene ID:
379764 (Xenopus laevis, CREB1)
Synonyms:
CREB1, creb1, CREB, Creb1, creb1.S, creb1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3843021
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CAMP Responsive Element Binding Protein 1 (CREB1)
Gene ID:
281713 (Cow (Bovine), CREB1)
Synonyms:
CREB1, creb1, CREB, Creb1, creb1.S, creb1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3839114
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CAMP Responsive Element Binding Protein 1 (CREB1)
Gene ID:
407934 (Xenopus tropicalis, CREB1)
Synonyms:
CREB1, creb1, CREB, Creb1, creb1.S, creb1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3882872
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CAMP Responsive Element Binding Protein 1 (CREB1)
Gene ID:
12912 (Mouse (Murine), CREB1)
Synonyms:
CREB1, creb1, CREB, Creb1, creb1.S, creb1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3463319
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CAMP Responsive Element Binding Protein 1 (CREB1)
Gene ID:
1385 (Human, CREB1)
Synonyms:
CREB1, creb1, CREB, Creb1, creb1.S, creb1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3803567
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CAMP Responsive Element Binding Protein 1 (CREB1)
Gene ID:
1385 (Human, CREB1)
Synonyms:
CREB1, creb1, CREB, Creb1, creb1.S, creb1a
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4210852
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
cAMP Responsive Element Binding Protein 1 (CREB1)
NCBI Accession:
NM_004379
Species:
Human
Synonyms:
CREB1, creb1, CREB, Creb1, creb1.S, creb1a
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3887826
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
cAMP Responsive Element Binding Protein 1 (CREB1)
NCBI Accession:
NM_001037726
Species:
Mouse (Murine)
Synonyms:
CREB1, creb1, CREB, Creb1, creb1.S, creb1a
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558852
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Application:
Quantitative real-time PCR
Gene:
cAMP Responsive Element Binding Protein 1
Species:
Human
Synonyms:
creb, CREB1, Creb1, CREB, 2310001E10Rik, 3526402H21Rik, AV083133, Creb, Creb-1, creb1, zgc:55598
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188495
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
cAMP Responsive Element Binding Protein 1
Species:
Mouse (Murine)
Synonyms:
creb, CREB1, Creb1, CREB, 2310001E10Rik, 3526402H21Rik, AV083133, Creb, Creb-1, creb1, zgc:55598
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3195382
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
ORF
Application:
Cloning
Gene:
cAMP Responsive Element Binding Protein 1 (CREB1)
Species:
Human
Synonyms:
CREB1, creb1, CREB, Creb1, creb1.S, creb1a
Insert length:
1026 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5721596
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CAMP Responsive Element Binding Protein 1 (CREB1)
Gene ID:
379764 (Xenopus laevis, CREB1)
Synonyms:
CREB1, creb1, CREB, Creb1, creb1.S, creb1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3843022
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CAMP Responsive Element Binding Protein 1 (CREB1)
Gene ID:
12912 (Mouse (Murine), CREB1)
Synonyms:
CREB1, creb1, CREB, Creb1, creb1.S, creb1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3808163
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CAMP Responsive Element Binding Protein 1 (CREB1)
Gene ID:
281713 (Cow (Bovine), CREB1)
Synonyms:
CREB1, creb1, CREB, Creb1, creb1.S, creb1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3839112
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CAMP Responsive Element Binding Protein 1 (CREB1)
Gene ID:
407934 (Xenopus tropicalis, CREB1)
Synonyms:
CREB1, creb1, CREB, Creb1, creb1.S, creb1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3882873
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
CAMP Responsive Element Binding Protein 1 (CREB1)
Gene ID:
1385 (Human, CREB1)
Synonyms:
CREB1, creb1, CREB, Creb1, creb1.S, creb1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3803566
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
CAMP Responsive Element Binding Protein 1 (CREB1)
Gene ID:
1385 (Human, CREB1)
Synonyms:
CREB1, creb1, CREB, Creb1, creb1.S, creb1a
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4210853
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
cAMP Responsive Element Binding Protein 1 (CREB1)
Gene ID:
1385 (Human, CREB1)
Synonyms:
CREB1, creb1, CREB, Creb1, creb1.S, creb1a
Insert length:
1026 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5316585
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
CAMP Responsive Element Binding Protein 1 (CREB1)
NCBI Accession:
NM_134442,NP_604391
Species:
Human
Synonyms:
CREB1, creb1, CREB, Creb1, creb1.S, creb1a
Insert length:
3180 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3382009
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
cAMP Responsive Element Binding Protein 1 (CREB1)
NCBI Accession:
NM_134442,NP_604391
Species:
Human
Synonyms:
CREB1, creb1, CREB, Creb1, creb1.S, creb1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948179

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Westbom, Shukla, MacPherson, Yasewicz, Miller, Beuschel, Steele, Pass, Vacek, Shukla: "CREB-induced inflammation is important for malignant mesothelioma growth." in: The American journal of pathology, Vol. 184, Issue 10, pp. 2816-27, 2014 (Pubmed)
Catalog No. ABIN3316805
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to CREB1

  • cAMP responsive element binding protein 1 (CREB1)
  • cAMP responsive element binding protein 1 (creb1)
  • cAMP responsive element binding protein (CREB)
  • cAMP responsive element binding protein 1 (Creb1)
  • cAMP responsive element binding protein 1 S homeolog (creb1.S)
  • cAMP responsive element binding protein 1a (creb1a)
  • 2310001E10Rik
  • 3526402H21Rik
  • AV083133
  • creb
  • CREB
  • Creb
  • Creb-1
  • CREB1
  • Creb1
  • creb1
  • zgc:55598

Gene-IDs for different species

GENE IDSPECIES
100066388 Equus caballus
407934 Xenopus (Silurana) tropicalis
459901 Pan troglodytes
692871 Bombyx mori
708717 Macaca mulatta
751585 Taeniopygia guttata
100294619 Pongo abelii
100351999 Oryctolagus cuniculus
100542127 Meleagris gallopavo
100586647 Nomascus leucogenys
1385 Homo sapiens
12912 Mus musculus
81646 Rattus norvegicus
395099 Gallus gallus
607922 Canis lupus familiaris
397449 Sus scrofa
281713 Bos taurus
379764 Xenopus laevis
573207 Danio rerio
443118 Ovis aries

Protein level used designations for CREB1

  • cAMP responsive element binding protein 1
  • cAMP responsive element binding protein
  • cyclic AMP-responsive element-binding protein 1
  • CREB-1
  • active transcription factor CREB
  • cAMP-response element-binding protein-1
  • cAMP-responsive element-binding protein 1
  • transactivator protein
  • Y protein
  • cAMP response element binding protein 1
  • cAMP response element-binding protein
  • cyclic AMP-responsive element binding protein, delta
  • cyclic AMP-responsive DNA-binding protein
Other products related to CREB1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com