CSNK1A1L (Casein Kinase 1, alpha 1-Like, CSNK1A1L)

Short Description: Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. It can phosphorylate a large number of proteins. Participates in Wnt signaling (By similarity).
More information related to gene CSNK1A1L.
Products related to CSNK1A1L Gene:
55 Products
Type
  • 52
  • 3
Species
  • 55
Application
  • 33
  • 9
  • 9
  • 7
  • 1
Fusion tag
  • 18
  • 6
  • 5
  • 4
  • 4
Vector Backbone
  • 2
  • 2
  • 2
  • 2
  • 2
Vector
  • 23
  • 14
  • 4
  • 4
  • 3
Insert
  • 26
  • 12
  • 7
  • 3
  • 2
Oligo-Type
  • 2
  • 1
Resistance Gene
  • 25
  • 18
  • 6
  • 3
  • 2
Expression Type
  • 32
  • 20
  • 13
Selectable Marker
  • 13
  • 10
  • 9
  • 1
Promoter
  • 16
  • 12
  • 12
  • 5
  • 4
Format
  • 30
  • 9
  • 8
  • 8

Type:
cDNA
Application:
Cloning
Gene:
Casein Kinase 1, alpha 1-Like (CSNK1A1L)
Gene ID:
122011 (Human, CSNK1A1L)
Synonyms:
CSNK1A1L, LOC100334765, LOC100356196, LOC100361046, LOC100378233
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4213692
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Casein Kinase 1, alpha 1-Like (CSNK1A1L)
NCBI Accession:
NM_145203
Species:
Human
Synonyms:
CSNK1A1L, LOC100334765, LOC100356196, LOC100361046, LOC100378233
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3886674
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Casein Kinase 1, alpha 1-Like
Species:
Human
Synonyms:
CK1
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189791
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
ORF
Application:
Cloning
Gene:
Casein Kinase 1, alpha 1-Like (CSNK1A1L)
Species:
Human
Synonyms:
CSNK1A1L, LOC100334765, LOC100356196, LOC100361046, LOC100378233
Insert length:
1014 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5743640
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Casein Kinase 1, alpha 1-Like (CSNK1A1L)
Gene ID:
122011 (Human, CSNK1A1L)
Synonyms:
CSNK1A1L, LOC100334765, LOC100356196, LOC100361046, LOC100378233
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4213693
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Casein Kinase 1, alpha 1-Like (CSNK1A1L)
Gene ID:
122011 (Human, CSNK1A1L)
Synonyms:
CSNK1A1L, LOC100334765, LOC100356196, LOC100361046, LOC100378233
Insert length:
1014 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5316550
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Casein Kinase 1, alpha 1-Like (CSNK1A1L)
NCBI Accession:
NM_145203,NP_660204
Species:
Human
Synonyms:
CSNK1A1L, LOC100334765, LOC100356196, LOC100361046, LOC100378233
Insert length:
2428 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3389147
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Casein Kinase 1, alpha 1-Like (CSNK1A1L)
Species:
Human
Synonyms:
CSNK1A1L, LOC100334765, LOC100356196, LOC100361046, LOC100378233
Insert length:
1014 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4474340
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Casein Kinase 1, alpha 1-Like (CSNK1A1L)
Species:
Human
Synonyms:
CSNK1A1L, LOC100334765, LOC100356196, LOC100361046, LOC100378233
Insert length:
1014 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4700489
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Casein Kinase 1, alpha 1-Like (CSNK1A1L)
Species:
Human
Synonyms:
CSNK1A1L, LOC100334765, LOC100356196, LOC100361046, LOC100378233
Insert length:
1014 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4760715
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Casein Kinase 1, alpha 1-Like (CSNK1A1L)
Species:
Human
Synonyms:
CSNK1A1L, LOC100334765, LOC100356196, LOC100361046, LOC100378233
Insert length:
1014 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4766008
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Casein Kinase 1, alpha 1-Like (CSNK1A1L)
Species:
Human
Synonyms:
CSNK1A1L, LOC100334765, LOC100356196, LOC100361046, LOC100378233
Insert length:
1014 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4435435
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Casein Kinase 1, alpha 1-Like (CSNK1A1L)
Species:
Human
Synonyms:
CSNK1A1L, LOC100334765, LOC100356196, LOC100361046, LOC100378233
Insert length:
1014 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4829618
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Casein Kinase 1, alpha 1-Like (CSNK1A1L)
Gene ID:
122011 (Human, CSNK1A1L)
Synonyms:
CSNK1A1L, LOC100334765, LOC100356196, LOC100361046, LOC100378233
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3419069
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Casein Kinase 1, alpha 1-Like (CSNK1A1L)
Gene ID:
122011 (Human, CSNK1A1L)
Synonyms:
CSNK1A1L, LOC100334765, LOC100356196, LOC100361046, LOC100378233
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3396732
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Casein Kinase 1, alpha 1-Like (CSNK1A1L)
Gene ID:
122011 (Human, CSNK1A1L)
Synonyms:
CSNK1A1L, LOC100334765, LOC100356196, LOC100361046, LOC100378233
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3422251
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Casein Kinase 1, alpha 1-Like (CSNK1A1L)
NCBI Accession:
NM_145203,NP_660204
Species:
Human
Synonyms:
CSNK1A1L, LOC100334765, LOC100356196, LOC100361046, LOC100378233
Insert length:
1014 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5411850
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Application:
RNA Interference
Gene:
Casein Kinase 1, alpha 1-Like
Species:
Human
Synonyms:
CK1
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • CSNK1A1L (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3311750
$420.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Casein Kinase 1, alpha 1-Like (CSNK1A1L)
NCBI Accession:
NM_145203
Species:
Human
Synonyms:
CSNK1A1L, LOC100334765, LOC100356196, LOC100361046, LOC100378233
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of CSNK1A1L
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5124730
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
Casein Kinase 1, alpha 1-Like (CSNK1A1L)
Gene ID:
122011 (Human, CSNK1A1L)
Synonyms:
CSNK1A1L, LOC100334765, LOC100356196, LOC100361046, LOC100378233
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Resistance Gene:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Stable, Transient

Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3403922
$458.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to CSNK1A1L

  • casein kinase 1 alpha 1 like (CSNK1A1L)
  • casein kinase I isoform alpha-like (LOC100334765)
  • casein kinase I-like (LOC100356196)
  • casein kinase 1, alpha 1-like (LOC100361046)
  • casein kinase I isoform alpha-like (LOC100378233)
  • CK1

Gene-IDs for different species

GENE IDSPECIES
122011 Homo sapiens
467264 Pan troglodytes
100334765 Danio rerio
100356196 Oryctolagus cuniculus
100361046 Rattus norvegicus
100378233 Saccoglossus kowalevskii

Protein level used designations for CSNK1A1L

  • CKI-alpha-like
  • casein kinase I alpha S-like
  • casein kinase I isoform alpha-like
  • casein kinase 1, alpha 1-like
Other products related to CSNK1A1L such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com