CST7 (Cystatin F (Leukocystatin), CST7)

Short Description: The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. This gene encodes a glycosylated cysteine protease inhibitor with a putative role in immune regulation through inhibition of a unique target in the hematopoietic system. Expression of the protein has been observed in various human cancer cell lines established from malignant tumors. [provided by RefSeq, Jul 2008].
More information related to gene CST7.
Products related to CST7 Gene:
  • 113
  • 4
  • 49
  • 41
  • 25
  • 1
  • 1
  • 71
  • 23
  • 20
  • 16
  • 2
Fusion tag
  • 37
  • 13
  • 13
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
  • 46
  • 36
  • 12
  • 9
  • 5
  • 45
  • 34
  • 18
  • 8
  • 6
  • 2
  • 2
Resistance Gene
  • 51
  • 38
  • 18
  • 6
  • 2
Expression Type
  • 84
  • 47
  • 22
Selectable Marker
  • 26
  • 24
  • 22
  • 1
  • 31
  • 28
  • 28
  • 13
  • 8
  • 56
  • 27
  • 22
  • 12
117 Products

Cystatin F (Leukocystatin) (CST7)
CST7, cytf, Cst7
Insert length:
504 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5745054
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression
Cystatin F (Leukocystatin) (CST7)
NCBI Accession:
CST7, cytf, Cst7
Insert length:
504 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5416509
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Cystatin F (Leukocystatin) (CST7)
NCBI Accession:
CST7, cytf, Cst7
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:

Sequencing Primer:
  • M13-47
  • RV-M
Catalog No. ABIN3886684
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Cystatin F (Leukocystatin) (CST7)
NCBI Accession:
CST7, cytf, Cst7
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:

Sequencing Primer:
  • M13-47 and RV-M
Catalog No. ABIN3558926
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Protein Expression, Cloning
Cystatin F (Leukocystatin) (CST7)
Gene ID:
8530 (Human, CST7)
CST7, cytf, Cst7
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3465575
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Cystatin F (Leukocystatin) (CST7)
Gene ID:
100037093 (Xenopus laevis, CST7)
CST7, cytf, Cst7
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3872018
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Cystatin F (Leukocystatin) (CST7)
Gene ID:
496776 (Xenopus tropicalis, CST7)
CST7, cytf, Cst7
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4060095
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Cystatin F (Leukocystatin) (CST7)
Gene ID:
13011 (Mouse, CST7)
CST7, cytf, Cst7
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4002030
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Cystatin F (Leukocystatin) (CST7)
Gene ID:
13011 (Mouse, CST7)
CST7, cytf, Cst7
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4002031
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Quantitative real-time PCR
Cystatin F (Leukocystatin)
CST7, LOC100232568, cytf, CMAP, Cmap
-20 °C
Catalog No. ABIN3188570
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Quantitative real-time PCR
Cystatin F (Leukocystatin)
CST7, LOC100232568, cytf, CMAP, Cmap
-20 °C
Catalog No. ABIN3193818
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Cystatin F (Leukocystatin) (CST7)
Gene ID:
8530 (Human, CST7)
CST7, cytf, Cst7
Insert length:
504 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5319012
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Cystatin F (Leukocystatin) (CST7)
CST7, cytf, Cst7
Insert length:
504 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4700517
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Cystatin F (Leukocystatin) (CST7)
CST7, cytf, Cst7
Insert length:
504 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4829646
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Cystatin F (Leukocystatin) (CST7)
CST7, cytf, Cst7
Insert length:
504 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4766030
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Cystatin F (Leukocystatin) (CST7)
CST7, cytf, Cst7
Insert length:
504 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4760737
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Cystatin F (Leukocystatin) (CST7)
CST7, cytf, Cst7
Insert length:
504 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4474362
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Cystatin F (Leukocystatin) (CST7)
CST7, cytf, Cst7
Insert length:
504 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4435457
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Cystatin F (Leukocystatin) (CST7)
Gene ID:
8530 (Human, CST7)
CST7, cytf, Cst7
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3429684
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
Cystatin F (Leukocystatin) (CST7)
Gene ID:
8530 (Human, CST7)
CST7, cytf, Cst7
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3395891
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to CST7

  • cystatin F (CST7)
  • Cystatin F (cytf)
  • cystatin F (leukocystatin) (Cst7)
  • cystatin F (Cst7)
  • CMAP
  • Cmap
  • CST7
  • cytf
  • LOC100232568

Gene-IDs for different species

740962 Pan troglodytes
100232568 Taeniopygia guttata
100305284 Oncorhynchus mykiss
8530 Homo sapiens
13011 Mus musculus
296257 Rattus norvegicus

Protein level used designations for CST7

  • cystatin F (leukocystatin)
  • Cystatin F
  • cystatin-7
  • cystatin-F
  • cystatin-like metastasis-associated protein
  • leukocystatin
  • cystatin 7
Other products related to CST7 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com