CST7 (Cystatin F (Leukocystatin), CST7)

Short Description: The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. This gene encodes a glycosylated cysteine protease inhibitor with a putative role in immune regulation through inhibition of a unique target in the hematopoietic system. Expression of the protein has been observed in various human cancer cell lines established from malignant tumors. [provided by RefSeq, Jul 2008].
More information related to gene CST7.
Products related to CST7 Gene:
126 Products
Type
  • 120
  • 6
Species
  • 52
  • 45
  • 25
  • 2
  • 2
Application
  • 74
  • 28
  • 24
  • 16
  • 2
Fusion tag
  • 44
  • 15
  • 13
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 51
  • 36
  • 12
  • 9
  • 7
Insert
  • 45
  • 39
  • 20
  • 8
  • 6
Oligo-Type
  • 4
  • 2
Resistance Gene
  • 53
  • 43
  • 18
  • 6
  • 2
Expression Type
  • 89
  • 49
  • 22
Selectable Marker
  • 28
  • 26
  • 22
  • 1
Promoter
  • 34
  • 30
  • 30
  • 13
  • 8
Format
  • 60
  • 27
  • 22
  • 17

Type:
ORF
Application:
Cloning
Gene:
Cystatin F (Leukocystatin) (CST7)
Species:
Human
Synonyms:
CST7, cytf, Cst7
Insert length:
504 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5745054
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Cystatin F (Leukocystatin) (CST7)
NCBI Accession:
NM_003650,NP_003641
Species:
Human
Synonyms:
CST7, cytf, Cst7
Insert length:
504 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5416509
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cystatin F (Leukocystatin) (CST7)
Gene ID:
8530 (Human, CST7)
Synonyms:
CST7, cytf, Cst7
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3465577
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cystatin F (Leukocystatin) (CST7)
Gene ID:
100037093 (Xenopus laevis, CST7)
Synonyms:
CST7, cytf, Cst7
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3872019
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cystatin F (Leukocystatin) (CST7)
Gene ID:
13011 (Mouse (Murine), CST7)
Synonyms:
CST7, cytf, Cst7
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4002032
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cystatin F (Leukocystatin) (CST7)
Gene ID:
13011 (Mouse (Murine), CST7)
Synonyms:
CST7, cytf, Cst7
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4002033
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cystatin F (Leukocystatin) (CST7)
Gene ID:
496776 (Xenopus tropicalis, CST7)
Synonyms:
CST7, cytf, Cst7
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4060096
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cystatin F (Leukocystatin) (CST7)
NCBI Accession:
NM_009977
Species:
Mouse (Murine)
Synonyms:
CST7, cytf, Cst7
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558926
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cystatin F (Leukocystatin) (CST7)
NCBI Accession:
NM_003650
Species:
Human
Synonyms:
CST7, cytf, Cst7
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3886684
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Cystatin F (Leukocystatin)
Species:
Mouse (Murine)
Synonyms:
CST7, LOC100232568, cytf, CMAP, Cmap
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193818
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Cystatin F (Leukocystatin)
Species:
Human
Synonyms:
CST7, LOC100232568, cytf, CMAP, Cmap
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188570
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cystatin F (Leukocystatin) (CST7)
Gene ID:
8530 (Human, CST7)
Synonyms:
CST7, cytf, Cst7
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3465575
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cystatin F (Leukocystatin) (CST7)
Gene ID:
100037093 (Xenopus laevis, CST7)
Synonyms:
CST7, cytf, Cst7
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3872018
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cystatin F (Leukocystatin) (CST7)
Gene ID:
13011 (Mouse (Murine), CST7)
Synonyms:
CST7, cytf, Cst7
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4002030
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cystatin F (Leukocystatin) (CST7)
Gene ID:
13011 (Mouse (Murine), CST7)
Synonyms:
CST7, cytf, Cst7
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4002031
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cystatin F (Leukocystatin) (CST7)
Gene ID:
496776 (Xenopus tropicalis, CST7)
Synonyms:
CST7, cytf, Cst7
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4060095
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Cystatin F (Leukocystatin) (CST7)
Gene ID:
8530 (Human, CST7)
Synonyms:
CST7, cytf, Cst7
Insert length:
504 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5319012
$179.56
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Cystatin F (Leukocystatin) (CST7)
Species:
Human
Synonyms:
CST7, cytf, Cst7
Insert length:
504 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4435457
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Cystatin F (Leukocystatin) (CST7)
Species:
Human
Synonyms:
CST7, cytf, Cst7
Insert length:
504 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4474362
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cystatin F (Leukocystatin) (CST7)
Species:
Human
Synonyms:
CST7, cytf, Cst7
Insert length:
504 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4766030
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to CST7

  • cystatin F (CST7)
  • Cystatin F (cytf)
  • cystatin F (leukocystatin) (Cst7)
  • cystatin F (Cst7)
  • CMAP
  • Cmap
  • CST7
  • cytf
  • LOC100232568

Gene-IDs for different species

GENE IDSPECIES
740962 Pan troglodytes
100232568 Taeniopygia guttata
100305284 Oncorhynchus mykiss
8530 Homo sapiens
13011 Mus musculus
296257 Rattus norvegicus

Protein level used designations for CST7

  • cystatin F (leukocystatin)
  • Cystatin F
  • cystatin-7
  • cystatin-F
  • cystatin-like metastasis-associated protein
  • leukocystatin
  • cystatin 7
Other products related to CST7 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com