F2RL3 (Coagulation Factor II (Thrombin) Receptor-Like 3, F2RL3)

Short Description: Coagulation factor II (thrombin) receptor-like 3 (F2RL3) is a member of the large family of 7-transmembrane-region receptors that couple to guanosine-nucleotide-binding proteins. F2RL3 is also a member of the protease-activated receptor family. F2RL3 is activated by proteolytic cleavage of its extracellular amino terminus. The new amino terminus functions as a tethered ligand and activates the receptor. F2RL3 is activated by thrombin and trypsin. [provided by RefSeq, Jul 2008].
More information related to gene F2RL3.
Products related to F2RL3 Gene:
93 Products
Type
  • 87
  • 6
Species
  • 35
  • 30
  • 26
  • 2
Application
  • 45
  • 25
  • 21
  • 16
Fusion tag
  • 33
  • 16
  • 10
  • 9
  • 6
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 4
Vector
  • 33
  • 26
  • 12
  • 9
  • 7
Insert
  • 33
  • 19
  • 19
  • 8
  • 6
Oligo-Type
  • 6
Resistance Gene
  • 36
  • 30
  • 18
  • 3
  • 2
Expression Type
  • 83
  • 47
Selectable Marker
  • 27
  • 24
  • 2
Promoter
  • 31
  • 31
  • 13
  • 8
  • 7
Format
  • 36
  • 27
  • 21
  • 9

Type:
cDNA
Application:
Cloning
Gene:
Coagulation Factor II (Thrombin) Receptor-Like 3 (F2RL3)
Gene ID:
14065 (Mouse (Murine), F2RL3)
Synonyms:
F2RL3, F2rl3
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3987876
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Coagulation Factor II (Thrombin) Receptor-Like 3 (F2RL3)
Gene ID:
538963 (Cow (Bovine), F2RL3)
Synonyms:
F2RL3, F2rl3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3863570
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Coagulation Factor II (Thrombin) Receptor-Like 3 (F2RL3)
Gene ID:
9002 (Human, F2RL3)
Synonyms:
F2RL3, F2rl3
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000993
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Coagulation Factor II (Thrombin) Receptor-Like 3 (F2RL3)
Gene ID:
14065 (Mouse (Murine), F2RL3)
Synonyms:
F2RL3, F2rl3
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3987877
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Coagulation Factor II (Thrombin) Receptor-Like 3 (F2RL3)
Gene ID:
538963 (Cow (Bovine), F2RL3)
Synonyms:
F2RL3, F2rl3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3863571
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Coagulation Factor II (Thrombin) Receptor-Like 3 (F2RL3)
Gene ID:
9002 (Human, F2RL3)
Synonyms:
F2RL3, F2rl3
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000992
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Coagulation Factor II (Thrombin) Receptor-Like 3 (F2RL3)
Species:
Human
Synonyms:
F2RL3, F2rl3
Insert length:
1158 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4701930
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Coagulation Factor II (Thrombin) Receptor-Like 3 (F2RL3)
Species:
Human
Synonyms:
F2RL3, F2rl3
Insert length:
1158 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4831060
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Coagulation Factor II (Thrombin) Receptor-Like 3 (F2RL3)
NCBI Accession:
NM_003950,NP_003941
Species:
Human
Synonyms:
F2RL3, F2rl3
Insert length:
2200 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3377953
$310.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Coagulation Factor II (Thrombin) Receptor-Like 3 (F2RL3)
NCBI Accession:
NM_003950
Gene ID:
9002 (Human, F2RL3)
Synonyms:
F2RL3, F2rl3
Insert length:
1158 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4939631
$379.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Coagulation Factor II (Thrombin) Receptor-Like 3 (F2RL3)
NCBI Accession:
NM_053808,NP_446260
Species:
Rat (Rattus)
Synonyms:
F2RL3, F2rl3
Insert length:
1161 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3292202
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Coagulation Factor II (Thrombin) Receptor-Like 3 (F2RL3)
NCBI Accession:
NM_007975,NP_032001
Species:
Mouse (Murine)
Synonyms:
F2RL3, F2rl3
Insert length:
1191 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3292201
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Coagulation Factor II (Thrombin) Receptor-Like 3 (F2RL3)
NCBI Accession:
NM_003950
Species:
Human
Synonyms:
F2RL3, F2rl3
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of F2RL3
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5081894
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Coagulation Factor II (Thrombin) Receptor-Like 3 (F2RL3)
NCBI Accession:
NM_007975
Species:
Mouse (Murine)
Synonyms:
F2RL3, F2rl3
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of F2rl3
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5081896
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Coagulation Factor II (Thrombin) Receptor-Like 3 (F2RL3)
NCBI Accession:
NM_053808
Species:
Rat (Rattus)
Synonyms:
F2RL3, F2rl3
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of F2rl3
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5081898
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
Coagulation Factor II (Thrombin) Receptor-Like 3 (F2RL3)
NCBI Accession:
NM_003950,NP_003941
Species:
Human
Synonyms:
F2RL3, F2rl3
Insert length:
1158 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5498303
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Coagulation Factor II (Thrombin) Receptor-Like 3 (F2RL3)
NCBI Accession:
NM_053808,NP_446260
Species:
Rat (Rattus)
Synonyms:
F2RL3, F2rl3
Insert length:
1196 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5498304
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Application:
RNA Interference
Gene:
Coagulation Factor II (Thrombin) Receptor-Like 3
Species:
Mouse (Murine)
Synonyms:
F2RL3, PAR4
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • F2rl3 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3281673
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Coagulation Factor II (Thrombin) Receptor-Like 3
Species:
Human
Synonyms:
F2RL3, PAR4
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • F2RL3 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3345703
$430.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Application:
RNA Interference
Gene:
Coagulation Factor II (Thrombin) Receptor-Like 3
Species:
Rat (Rattus)
Synonyms:
F2RL3, PAR4
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • F2rl3 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3357464
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to F2RL3

  • F2R like thrombin or trypsin receptor 3 (F2RL3)
  • F2R like thrombin/trypsin receptor 3 (F2RL3)
  • coagulation factor II (thrombin) receptor-like 3 (F2rl3)
  • F2R like thrombin or trypsin receptor 3 (F2rl3)
  • F2RL3
  • PAR4

Gene-IDs for different species

GENE IDSPECIES
538963 Bos taurus
484846 Canis lupus familiaris
420139 Gallus gallus
718843 Macaca mulatta
455829 Pan troglodytes
9002 Homo sapiens
14065 Mus musculus
116498 Rattus norvegicus

Protein level used designations for F2RL3

  • proteinase-activated receptor 4
  • coagulation factor II (thrombin) receptor-like 3
  • PAR-4
  • protease-activated receptor-4
  • thrombin receptor-like 3
  • coagulation factor II receptor-like 3
  • protease-activated receptor 4
Other products related to F2RL3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com