FABP3 (Fatty Acid Binding Protein 3, Muscle and Heart, FABP3)

Short Description: The intracellular fatty acid-binding proteins (FABPs) belongs to a multigene family. FABPs are divided into at least three distinct types, namely the hepatic-, intestinal- and cardiac-type. They form 14-15 kDa proteins and are thought to participate in the uptake, intracellular metabolism and/or transport of long-chain fatty acids. They may also be responsible in the modulation of cell growth and proliferation. Fatty acid-binding protein 3 gene contains four exons and its function is to arrest growth of mammary epithelial cells. This gene is a candidate tumor suppressor gene for human breast cancer. [provided by RefSeq, Jul 2008].
More information related to gene FABP3.
Products related to FABP3 Gene:
155 Products
Type
  • 146
  • 9
Species
  • 46
  • 43
  • 42
  • 14
  • 4
Application
  • 97
  • 34
  • 27
  • 16
  • 3
Fusion tag
  • 56
  • 16
  • 15
  • 10
  • 9
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 74
  • 36
  • 12
  • 10
  • 9
Insert
  • 64
  • 45
  • 21
  • 8
  • 6
Oligo-Type
  • 6
  • 3
Resistance Gene
  • 72
  • 45
  • 24
  • 5
  • 2
Expression Type
  • 94
  • 51
  • 40
  • 2
Selectable Marker
  • 40
  • 26
  • 26
  • 1
Promoter
  • 54
  • 31
  • 31
  • 12
  • 8
Format
  • 82
  • 27
  • 24
  • 22

Type:
ORF
Application:
Cloning
Gene:
Fatty Acid Binding Protein 3, Muscle and Heart (FABP3)
Species:
Human
Synonyms:
FABP3, Fabp3, fabp3
Insert length:
402 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5735125
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Fatty Acid Binding Protein 3, Muscle and Heart (FABP3)
NCBI Accession:
NM_004102,NP_004093
Species:
Human
Synonyms:
FABP3, Fabp3, fabp3
Insert length:
402 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5383785
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Fatty Acid Binding Protein 3, Muscle and Heart (FABP3)
NCBI Accession:
NM_004102
Gene ID:
2170 (Human, FABP3)
Synonyms:
FABP3, Fabp3, fabp3
Insert length:
402 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4939619
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Fatty Acid Binding Protein 3, Muscle and Heart (FABP3)
Gene ID:
171478 (Zebrafish (Danio rerio), FABP3)
Synonyms:
FABP3, Fabp3, fabp3
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4071935
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Fatty Acid Binding Protein 3, Muscle and Heart (FABP3)
Gene ID:
281758 (Cow (Bovine), FABP3)
Synonyms:
FABP3, Fabp3, fabp3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3839164
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Fatty Acid Binding Protein 3, Muscle and Heart (FABP3)
Gene ID:
548540 (Xenopus tropicalis, FABP3)
Synonyms:
FABP3, Fabp3, fabp3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3983873
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Fatty Acid Binding Protein 3, Muscle and Heart (FABP3)
Gene ID:
548540 (Xenopus tropicalis, FABP3)
Synonyms:
FABP3, Fabp3, fabp3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4030034
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Fatty Acid Binding Protein 3, Muscle and Heart (FABP3)
Gene ID:
2170 (Human, FABP3)
Synonyms:
FABP3, Fabp3, fabp3
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4034659
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Fatty Acid Binding Protein 3, Muscle and Heart (FABP3)
Gene ID:
14077 (Mouse (Murine), FABP3)
Synonyms:
FABP3, Fabp3, fabp3
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4036524
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Fatty Acid Binding Protein 3, Muscle and Heart (FABP3)
Gene ID:
14077 (Mouse (Murine), FABP3)
Synonyms:
FABP3, Fabp3, fabp3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4214620
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Fatty Acid Binding Protein 3, Muscle and Heart (FABP3)
Gene ID:
379613 (Xenopus laevis, FABP3)
Synonyms:
FABP3, Fabp3, fabp3
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4041113
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Fatty Acid Binding Protein 3, Muscle and Heart (FABP3)
NCBI Accession:
XM_005544157
Species:
Cynomolgus
Synonyms:
FABP3, Fabp3, fabp3
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3559858
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Fatty Acid Binding Protein 3, Muscle and Heart (FABP3)
Species:
Mouse (Murine)
Synonyms:
FABP3, Fabp3, fabp3
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3559859
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Fatty Acid Binding Protein 3, Muscle and Heart
Species:
Rat (Rattus)
Synonyms:
Fabph-1, Fabph-4, Fabph1, Fabph4, H-FABP, Mdgi, FABP11, M-FABP, MDGI, O-FABP, FABP, FABP-3, fabp3
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196866
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Fatty Acid Binding Protein 3, Muscle and Heart
Species:
Mouse (Murine)
Synonyms:
Fabph-1, Fabph-4, Fabph1, Fabph4, H-FABP, Mdgi, FABP11, M-FABP, MDGI, O-FABP, FABP, FABP-3, fabp3
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194672
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Fatty Acid Binding Protein 3, Muscle and Heart
Species:
Human
Synonyms:
Fabph-1, Fabph-4, Fabph1, Fabph4, H-FABP, Mdgi, FABP11, M-FABP, MDGI, O-FABP, FABP, FABP-3, fabp3
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193139
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Fatty Acid Binding Protein 3, Muscle and Heart (FABP3)
Gene ID:
171478 (Zebrafish (Danio rerio), FABP3)
Synonyms:
FABP3, Fabp3, fabp3
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4071936
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Fatty Acid Binding Protein 3, Muscle and Heart (FABP3)
Gene ID:
281758 (Cow (Bovine), FABP3)
Synonyms:
FABP3, Fabp3, fabp3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3839165
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Fatty Acid Binding Protein 3, Muscle and Heart (FABP3)
Gene ID:
548540 (Xenopus tropicalis, FABP3)
Synonyms:
FABP3, Fabp3, fabp3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3983874
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Fatty Acid Binding Protein 3, Muscle and Heart (FABP3)
Gene ID:
548540 (Xenopus tropicalis, FABP3)
Synonyms:
FABP3, Fabp3, fabp3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4030035
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to FABP3

  • fatty acid binding protein 3 (FABP3)
  • fatty acid binding protein 3 (Fabp3)
  • fatty acid binding protein 3, muscle and heart (Fabp3)
  • fatty acid binding protein 3 (fabp3)
  • FABP
  • FABP-3
  • fabp3
  • FABP11
  • Fabph-1
  • Fabph-4
  • Fabph1
  • Fabph4
  • H-FABP
  • M-FABP
  • Mdgi
  • MDGI
  • O-FABP

Gene-IDs for different species

GENE IDSPECIES
100348000 Oryctolagus cuniculus
79131 Rattus norvegicus
14077 Mus musculus
2170 Homo sapiens
419557 Gallus gallus
478156 Canis lupus familiaris
399532 Sus scrofa
281758 Bos taurus
100136763 Oncorhynchus mykiss

Protein level used designations for FABP3

  • Fatty acid binding protein 3 heart
  • H-FABP
  • fatty acid binding protein 3 heart
  • fatty acid-binding protein 3
  • fatty acid-binding protein, heart
  • heart fatty acid binding protein
  • heart-type fatty acid-binding protein
  • fatty acid binding protein heart 1
  • fatty acid binding protein heart 4
  • mammary-derived growth inhibitor
  • Fatty acid-binding protein 3, muscle
  • fatty acid binding protein 11
  • muscle fatty acid-binding protein
  • heart fatty acid-binding protein
  • heart-type fatty acid binding protein
  • MDGI
  • fatty acid binding protein ( heart ) like
Other products related to FABP3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com