FOXO3 (Forkhead Box O3, FOXO3)

Short Description: This gene belongs to the forkhead family of transcription factors which are characterized by a distinct forkhead domain. This gene likely functions as a trigger for apoptosis through expression of genes necessary for cell death. Translocation of this gene with the MLL gene is associated with secondary acute leukemia. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008].
More information related to gene FOXO3.
Products related to FOXO3 Gene:
115 Products
Data Quality
  • 7
Type
  • 109
  • 6
Species
  • 50
  • 31
  • 26
  • 4
  • 2
Application
  • 58
  • 30
  • 27
  • 16
Fusion tag
  • 46
  • 18
  • 13
  • 9
  • 8
Vector Backbone
  • 8
  • 8
  • 6
  • 6
  • 6
Vector
  • 40
  • 31
  • 13
  • 12
  • 10
Insert
  • 43
  • 29
  • 21
  • 8
  • 6
Oligo-Type
  • 6
Resistance Gene
  • 42
  • 34
  • 27
  • 6
  • 2
Expression Type
  • 96
  • 52
Selectable Marker
  • 30
  • 27
  • 1
Promoter
  • 36
  • 31
  • 14
  • 12
  • 8
Format
  • 43
  • 27
  • 24
  • 21

Type:
cDNA
Application:
Cloning
Gene:
Forkhead Box O3 (FOXO3)
Gene ID:
30296 (Zebrafish (Danio rerio), FOXO3)
Synonyms:
FOXO3, foxo3a, Foxo3, foxo3.L, foxo3, foxO3
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4005201
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Forkhead Box O3 (FOXO3)
Gene ID:
494532 (Zebrafish (Danio rerio), FOXO3)
Synonyms:
FOXO3, foxo3a, Foxo3, foxo3.L, foxo3, foxO3
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4059292
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Forkhead Box O3 (FOXO3)
Gene ID:
100125025 (Xenopus tropicalis, FOXO3)
Synonyms:
FOXO3, foxo3a, Foxo3, foxo3.L, foxo3, foxO3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3872613
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Forkhead Box O3 (FOXO3)
Gene ID:
2309 (Human, FOXO3)
Synonyms:
FOXO3, foxo3a, Foxo3, foxo3.L, foxo3, foxO3
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4084317
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Forkhead Box O3 (FOXO3)
Gene ID:
2309 (Human, FOXO3)
Synonyms:
FOXO3, foxo3a, Foxo3, foxo3.L, foxo3, foxO3
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4084316
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Forkhead Box O3 (FOXO3)
Gene ID:
444992 (Xenopus laevis, FOXO3)
Synonyms:
FOXO3, foxo3a, Foxo3, foxo3.L, foxo3, foxO3
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4020936
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Forkhead Box O3 (FOXO3)
Gene ID:
2309 (Human, FOXO3)
Synonyms:
FOXO3, foxo3a, Foxo3, foxo3.L, foxo3, foxO3
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4210988
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Forkhead Box O3 (FOXO3)
Gene ID:
30296 (Zebrafish (Danio rerio), FOXO3)
Synonyms:
FOXO3, foxo3a, Foxo3, foxo3.L, foxo3, foxO3
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4005200
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Forkhead Box O3 (FOXO3)
Gene ID:
494532 (Zebrafish (Danio rerio), FOXO3)
Synonyms:
FOXO3, foxo3a, Foxo3, foxo3.L, foxo3, foxO3
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4059291
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Forkhead Box O3 (FOXO3)
Species:
Human
Synonyms:
FOXO3, foxo3a, Foxo3, foxo3.L, foxo3, foxO3
Insert length:
2022 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5734310
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Forkhead Box O3 (FOXO3)
Gene ID:
100125025 (Xenopus tropicalis, FOXO3)
Synonyms:
FOXO3, foxo3a, Foxo3, foxo3.L, foxo3, foxO3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3872612
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Forkhead Box O3 (FOXO3)
Gene ID:
2309 (Human, FOXO3)
Synonyms:
FOXO3, foxo3a, Foxo3, foxo3.L, foxo3, foxO3
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4084318
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Forkhead Box O3 (FOXO3)
Gene ID:
2309 (Human, FOXO3)
Synonyms:
FOXO3, foxo3a, Foxo3, foxo3.L, foxo3, foxO3
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4084319
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Forkhead Box O3 (FOXO3)
Gene ID:
444992 (Xenopus laevis, FOXO3)
Synonyms:
FOXO3, foxo3a, Foxo3, foxo3.L, foxo3, foxO3
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4020937
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Forkhead Box O3 (FOXO3)
Gene ID:
2309 (Human, FOXO3)
Synonyms:
FOXO3, foxo3a, Foxo3, foxo3.L, foxo3, foxO3
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4210989
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Forkhead Box O3 (FOXO3)
Gene ID:
2309 (Human, FOXO3)
Synonyms:
FOXO3, foxo3a, Foxo3, foxo3.L, foxo3, foxO3
Insert length:
2022 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5323377
$204.60
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Forkhead Box O3 (FOXO3)
NCBI Accession:
NM_001455,NP_001446
Species:
Human
Synonyms:
FOXO3, foxo3a, Foxo3, foxo3.L, foxo3, foxO3
Insert length:
2200 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Liu, Yin, Wang, Jiang, Deng, Zhang, Bu, Cai, Du, He: "FOXO3a modulates WNT/β-catenin signaling and suppresses epithelial-to-mesenchymal transition in prostate cancer cells." in: Cellular signalling, Vol. 27, Issue 3, pp. 510-8, 2015 (Pubmed)
  • Lim, Barker, Lappas: "A novel role for FOXO3 in human labor: increased expression in laboring myometrium, and regulation of proinflammatory and prolabor mediators in pregnant human myometrial cells." in: Biology of reproduction, Vol. 88, Issue 6, pp. 156, 2013 (Pubmed)
  • Arteaga, Alvarez de la Rosa, Alvarez, Canessa: "Multiple translational isoforms give functional specificity to serum- and glucocorticoid-induced kinase 1." in: Molecular biology of the cell, Vol. 18, Issue 6, pp. 2072-80, 2007 (Pubmed)
Catalog No. ABIN3378091
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Forkhead Box O3 (FOXO3)
Species:
Human
Synonyms:
FOXO3, foxo3a, Foxo3, foxo3.L, foxo3, foxO3
Insert length:
2022 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4503812
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Forkhead Box O3 (FOXO3)
Species:
Human
Synonyms:
FOXO3, foxo3a, Foxo3, foxo3.L, foxo3, foxO3
Insert length:
2022 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4702589
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Forkhead Box O3 (FOXO3)
Species:
Human
Synonyms:
FOXO3, foxo3a, Foxo3, foxo3.L, foxo3, foxO3
Insert length:
2022 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4767433
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to FOXO3

  • forkhead box O3 (FOXO3)
  • forkhead box O3A (foxo3a)
  • forkhead box O3 (Foxo3)
  • forkhead box O3 L homeolog (foxo3.L)
  • forkhead box O3 (foxo3)
  • forkhead box O3 (foxO3)
  • 1110048B16Rik
  • 2010203A17Rik
  • AF6q21
  • C76856
  • Fkhr2
  • Fkhrl1
  • FKHRL1
  • FKHRL1P2
  • foxO
  • FOXO-3
  • FOXO2
  • FOXO3
  • foxO3
  • Foxo3a
  • FOXO3A
  • foxo3a
  • FoxO3A
  • wu:fb50g02
  • wu:fi33f07
  • xfoxo3
  • zgc:92176

Gene-IDs for different species

GENE IDSPECIES
2309 Homo sapiens
733621 Sus scrofa
494532 Danio rerio
294515 Rattus norvegicus
444992 Xenopus laevis
56484 Mus musculus
535530 Bos taurus
421769 Gallus gallus
462921 Pan troglodytes
700731 Macaca mulatta
100066558 Equus caballus
100125025 Xenopus (Silurana) tropicalis
100303473 Saccoglossus kowalevskii
100406446 Callithrix jacchus
100451077 Pongo abelii
100600519 Nomascus leucogenys
481954 Canis lupus familiaris
100713179 Cavia porcellus
100913151 Ovis aries

Protein level used designations for FOXO3

  • forkhead box O3A
  • forkhead box protein O3
  • forkhead homolog (rhabdomyosarcoma) like 1
  • forkhead in rhabdomyosarcoma-like 1
  • forkhead, Drosophila, homolog of, in rhabdomyosarcoma-like 1
  • fb50g02
  • fi33f07
  • forkhead box O3a
  • xFoxO3
  • forkhead protein FKHR2
  • forkhead box O3A transcription factor
  • forkhead box O3
  • forkhead box O protein
  • forkhead box protein O3-like
Other products related to FOXO3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com