GAD (Glutamate Decarboxylase 1 (Brain, 67kDa), GAD1)

Short Description: This gene encodes one of several forms of glutamic acid decarboxylase, identified as a major autoantigen in insulin-dependent diabetes. The enzyme encoded is responsible for catalyzing the production of gamma-aminobutyric acid from L-glutamic acid. A pathogenic role for this enzyme has been identified in the human pancreas since it has been identified as an autoantigen and an autoreactive T cell target in insulin-dependent diabetes. This gene may also play a role in the stiff man syndrome. Deficiency in this enzyme has been shown to lead to pyridoxine dependency with seizures. Alternative splicing of this gene results in two products, the predominant 67-kD form and a less-frequent 25-kD form. [provided by RefSeq, Jul 2008].
More information related to gene GAD.
Products related to GAD Gene:
128 Products
Data Quality
  • 1
Type
  • 122
  • 6
Species
  • 71
  • 28
  • 25
  • 2
  • 2
Application
  • 65
  • 38
  • 25
  • 16
Fusion tag
  • 46
  • 18
  • 15
  • 12
  • 6
Vector Backbone
  • 7
  • 7
  • 6
  • 6
  • 6
Vector
  • 39
  • 36
  • 20
  • 11
  • 9
Insert
  • 53
  • 34
  • 19
  • 8
  • 6
Oligo-Type
  • 6
Resistance Gene
  • 52
  • 40
  • 20
  • 10
  • 2
Expression Type
  • 109
  • 58
Selectable Marker
  • 34
  • 24
  • 1
Promoter
  • 44
  • 31
  • 22
  • 8
  • 8
Format
  • 45
  • 44
  • 21
  • 18

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glutamate Decarboxylase 1 (Brain, 67kDa) (GAD1)
Gene ID:
517552 (Cow (Bovine), GAD1)
Synonyms:
GAD1, gad1.1.L, GAD, Gad1, gad1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3859945
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glutamate Decarboxylase 1 (Brain, 67kDa) (GAD1)
Gene ID:
2571 (Human, GAD1)
Synonyms:
GAD1, gad1.1.L, GAD, Gad1, gad1b
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211025
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glutamate Decarboxylase 1 (Brain, 67kDa) (GAD1)
Gene ID:
2571 (Human, GAD1)
Synonyms:
GAD1, gad1.1.L, GAD, Gad1, gad1b
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211027
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glutamate Decarboxylase 1 (Brain, 67kDa) (GAD1)
Gene ID:
2571 (Human, GAD1)
Synonyms:
GAD1, gad1.1.L, GAD, Gad1, gad1b
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211026
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Glutamate Decarboxylase 1 (Brain, 67kDa) (GAD1)
Species:
Human
Synonyms:
GAD1, gad1.1.L, GAD, Gad1, gad1b
Insert length:
675 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5734320
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Cloning
Gene:
Glutamate Decarboxylase 1 (Brain, 67kDa) (GAD1)
Species:
Human
Synonyms:
GAD1, gad1.1.L, GAD, Gad1, gad1b
Insert length:
1785 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5734321
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Cloning
Gene:
Glutamate Decarboxylase 1 (Brain, 67kDa) (GAD1)
Species:
Human
Synonyms:
GAD1, gad1.1.L, GAD, Gad1, gad1b
Insert length:
1785 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5734322
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glutamate Decarboxylase 1 (Brain, 67kDa) (GAD1)
Gene ID:
517552 (Cow (Bovine), GAD1)
Synonyms:
GAD1, gad1.1.L, GAD, Gad1, gad1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3859946
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glutamate Decarboxylase 1 (Brain, 67kDa) (GAD1)
Gene ID:
2571 (Human, GAD1)
Synonyms:
GAD1, gad1.1.L, GAD, Gad1, gad1b
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211022
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glutamate Decarboxylase 1 (Brain, 67kDa) (GAD1)
Gene ID:
2571 (Human, GAD1)
Synonyms:
GAD1, gad1.1.L, GAD, Gad1, gad1b
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211023
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glutamate Decarboxylase 1 (Brain, 67kDa) (GAD1)
Gene ID:
2571 (Human, GAD1)
Synonyms:
GAD1, gad1.1.L, GAD, Gad1, gad1b
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211024
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Glutamate Decarboxylase 1 (Brain, 67kDa) (GAD1)
Gene ID:
2571 (Human, GAD1)
Synonyms:
GAD1, gad1.1.L, GAD, Gad1, gad1b
Insert length:
675 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5314156
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Cloning
Gene:
Glutamate Decarboxylase 1 (Brain, 67kDa) (GAD1)
Gene ID:
2571 (Human, GAD1)
Synonyms:
GAD1, gad1.1.L, GAD, Gad1, gad1b
Insert length:
1785 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5318531
$204.60
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Cloning
Gene:
Glutamate Decarboxylase 1 (Brain, 67kDa) (GAD1)
Gene ID:
2571 (Human, GAD1)
Synonyms:
GAD1, gad1.1.L, GAD, Gad1, gad1b
Insert length:
1785 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5319687
$204.60
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Glutamate Decarboxylase 1 (Brain, 67kDa) (GAD1)
NCBI Accession:
NM_000817,NP_000808
Species:
Human
Synonyms:
GAD1, gad1.1.L, GAD, Gad1, gad1b
Insert length:
3270 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Gresa-Arribas, Ariño, Martínez-Hernández, Petit-Pedrol, Sabater, Saiz, Dalmau, Graus: "Antibodies to inhibitory synaptic proteins in neurological syndromes associated with glutamic acid decarboxylase autoimmunity." in: PLoS ONE, Vol. 10, Issue 3, pp. e0121364, 2015 (Pubmed)
Catalog No. ABIN3384167
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Glutamate Decarboxylase 1 (Brain, 67kDa) (GAD1)
Species:
Human
Synonyms:
GAD1, gad1.1.L, GAD, Gad1, gad1b
Insert length:
675 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4475878
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Glutamate Decarboxylase 1 (Brain, 67kDa) (GAD1)
Species:
Human
Synonyms:
GAD1, gad1.1.L, GAD, Gad1, gad1b
Insert length:
675 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4475879
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Glutamate Decarboxylase 1 (Brain, 67kDa) (GAD1)
Species:
Human
Synonyms:
GAD1, gad1.1.L, GAD, Gad1, gad1b
Insert length:
675 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4475880
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glutamate Decarboxylase 1 (Brain, 67kDa) (GAD1)
Species:
Human
Synonyms:
GAD1, gad1.1.L, GAD, Gad1, gad1b
Insert length:
1785 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4702766
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glutamate Decarboxylase 1 (Brain, 67kDa) (GAD1)
Species:
Human
Synonyms:
GAD1, gad1.1.L, GAD, Gad1, gad1b
Insert length:
675 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4702765
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to GAD

  • glutamate decarboxylase 1 (GAD1)
  • glutamate decarboxylase 1 L homeolog (gad1.1.L)
  • glutamate decarboxylase (GAD)
  • glutamate decarboxylase 1 (Gad1)
  • glutamate decarboxylase 1b (gad1b)
  • CPSQ1
  • cpsq1
  • EP10
  • GAD
  • Gad-1
  • GAD-67
  • gad1
  • GAD1
  • gad1-A
  • GAD25
  • GAD44
  • Gad67
  • GAD67
  • gad67
  • glutamate decarboxylase
  • GLUTAMATE DECARBOXYLASE
  • GLUTAMATE DECARBOXYLASE 1
  • MKP11.30
  • MKP11_30
  • SCP

Gene-IDs for different species

GENE IDSPECIES
2571 Homo sapiens
493699 Felis catus
468557 Pan troglodytes
378551 Xenopus laevis
778442 Taeniopygia guttata
478794 Canis lupus familiaris
100173252 Pongo abelii
517552 Bos taurus
831599 Arabidopsis thaliana
395743 Gallus gallus
14415 Mus musculus
24379 Rattus norvegicus
378441 Danio rerio
396928 Sus scrofa
100271904 Cavia porcellus

Protein level used designations for GAD

  • 67 kDa glutamic acid decarboxylase
  • GAD-67
  • glutamate decarboxylase 1
  • glutamate decarboxylase 67 kDa isoform
  • glutamic acid decarboxylase
  • glutamate decarboxylase, 67 kDa isoform
  • glutamic acid decarboxylase 1
  • glutamate decarboxylase 67
  • GLUTAMATE DECARBOXYLASE, 67 KD ISOFORM (GAD-67) (67 KD GLUTAMIC ACID DECARBOXYLASE)
  • Glutamate decarboxylase 1 (brain)
  • glutamate decarboxylase 1 variant GAD67NT
Other products related to GAD such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com