Gastrokine 1 (Gastrokine 1, GKN1)

Short Description: The protein encoded by this gene is found to be down-regulated in human gastric cancer tissue as compared to normal gastric mucosa. [provided by RefSeq, Jul 2008].
More information related to gene Gastrokine 1.
Products related to Gastrokine 1 Gene:
99 Products
Type
  • 94
  • 5
Species
  • 39
  • 34
  • 26
Application
  • 50
  • 25
  • 22
  • 16
Fusion tag
  • 37
  • 15
  • 10
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 36
  • 27
  • 12
  • 9
  • 7
Insert
  • 35
  • 23
  • 20
  • 8
  • 6
Oligo-Type
  • 5
Resistance Gene
  • 36
  • 34
  • 18
  • 6
  • 2
Expression Type
  • 87
  • 49
Selectable Marker
  • 29
  • 26
  • 1
Promoter
  • 30
  • 30
  • 14
  • 10
  • 8
Format
  • 37
  • 27
  • 22
  • 13

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Gastrokine 1 (GKN1)
Gene ID:
66283 (Mouse (Murine), GKN1)
Synonyms:
GKN1, gkn1, Gkn1, LOC100341246
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4047118
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Gastrokine 1 (GKN1)
Gene ID:
66283 (Mouse (Murine), GKN1)
Synonyms:
GKN1, gkn1, Gkn1, LOC100341246
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4007240
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Gastrokine 1 (GKN1)
Gene ID:
66283 (Mouse (Murine), GKN1)
Synonyms:
GKN1, gkn1, Gkn1, LOC100341246
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4007241
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Gastrokine 1 (GKN1)
Species:
Human
Synonyms:
GKN1, gkn1, Gkn1, LOC100341246
Insert length:
558 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5751795
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Gastrokine 1 (GKN1)
Gene ID:
66283 (Mouse (Murine), GKN1)
Synonyms:
GKN1, gkn1, Gkn1, LOC100341246
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4047119
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Gastrokine 1 (GKN1)
Gene ID:
66283 (Mouse (Murine), GKN1)
Synonyms:
GKN1, gkn1, Gkn1, LOC100341246
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4007242
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Gastrokine 1 (GKN1)
Gene ID:
66283 (Mouse (Murine), GKN1)
Synonyms:
GKN1, gkn1, Gkn1, LOC100341246
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4007243
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Gastrokine 1 (GKN1)
Gene ID:
56287 (Human, GKN1)
Synonyms:
GKN1, gkn1, Gkn1, LOC100341246
Insert length:
558 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5320561
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Gastrokine 1 (GKN1)
Species:
Human
Synonyms:
GKN1, gkn1, Gkn1, LOC100341246
Insert length:
558 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4437135
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Gastrokine 1 (GKN1)
Species:
Human
Synonyms:
GKN1, gkn1, Gkn1, LOC100341246
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3389872
$300.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Gastrokine 1 (GKN1)
Species:
Human
Synonyms:
GKN1, gkn1, Gkn1, LOC100341246
Insert length:
558 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4476040
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Gastrokine 1 (GKN1)
Species:
Human
Synonyms:
GKN1, gkn1, Gkn1, LOC100341246
Insert length:
558 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4703020
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Gastrokine 1 (GKN1)
Species:
Human
Synonyms:
GKN1, gkn1, Gkn1, LOC100341246
Insert length:
558 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4762415
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Gastrokine 1 (GKN1)
Species:
Human
Synonyms:
GKN1, gkn1, Gkn1, LOC100341246
Insert length:
558 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4767708
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Gastrokine 1 (GKN1)
Species:
Human
Synonyms:
GKN1, gkn1, Gkn1, LOC100341246
Insert length:
558 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4832150
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Gastrokine 1 (GKN1)
Gene ID:
56287 (Human, GKN1)
Synonyms:
GKN1, gkn1, Gkn1, LOC100341246
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3397752
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Gastrokine 1 (GKN1)
Gene ID:
56287 (Human, GKN1)
Synonyms:
GKN1, gkn1, Gkn1, LOC100341246
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3429469
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Gastrokine 1 (GKN1)
NCBI Accession:
NM_019617,NP_062563
Species:
Human
Synonyms:
GKN1, gkn1, Gkn1, LOC100341246
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3301098
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Gastrokine 1 (GKN1)
NCBI Accession:
NM_019617,NP_062563
Species:
Human
Synonyms:
GKN1, gkn1, Gkn1, LOC100341246
Insert length:
600 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3389873
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Gastrokine 1 (GKN1)
NCBI Accession:
NM_198972,NP_945323
Species:
Rat (Rattus)
Synonyms:
GKN1, gkn1, Gkn1, LOC100341246
Insert length:
552 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3289961
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
  • <
  • 1

Synonyms and alternative names related to Gastrokine 1

  • gastrokine 1 (GKN1)
  • gastrokine 1 (gkn1)
  • gastrokine 1 (Gkn1)
  • gastrokine-3-like (LOC100341246)
  • 2200002K21Rik
  • AMP-18
  • AMP18
  • Amp18
  • BRICD1
  • CA11
  • Ca11
  • Fov
  • FOV
  • foveolin
  • GKN1

Gene-IDs for different species

GENE IDSPECIES
735918 Pan troglodytes
100380101 Xenopus (Silurana) tropicalis
66283 Mus musculus
56287 Homo sapiens
100502561 Sus scrofa
297418 Rattus norvegicus
100720783 Cavia porcellus
612599 Canis lupus familiaris
407211 Bos taurus
769896 Gallus gallus
100341246 Oryctolagus cuniculus
100061374 Equus caballus

Protein level used designations for Gastrokine 1

  • gastrokine 1
  • 18 kDa antrum mucosa protein
  • foveolin
  • gastrokine-1
  • protein CA11 homolog
  • AMP-18
  • BRICHOS domain containing 1
Other products related to Gastrokine 1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com