GFAP (Glial Fibrillary Acidic Protein, GFAP)

Short Description: This gene encodes one of the major intermediate filament proteins of mature astrocytes. It is used as a marker to distinguish astrocytes from other glial cells during development. Mutations in this gene cause Alexander disease, a rare disorder of astrocytes in the central nervous system. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Oct 2008].
More information related to gene GFAP.
Products related to GFAP Gene:
160 Products
Data Quality
  • 1
  • 1
Type
  • 152
  • 8
Species
  • 67
  • 59
  • 30
  • 2
  • 2
Application
  • 100
  • 35
  • 27
  • 16
  • 2
Fusion tag
  • 51
  • 22
  • 16
  • 16
  • 8
Vector Backbone
  • 10
  • 10
  • 8
  • 6
  • 6
Vector
  • 70
  • 44
  • 16
  • 9
  • 8
Insert
  • 64
  • 51
  • 21
  • 8
  • 6
Oligo-Type
  • 6
  • 2
Resistance Gene
  • 70
  • 47
  • 28
  • 7
  • 2
Expression Type
  • 117
  • 58
  • 26
Selectable Marker
  • 37
  • 26
  • 26
  • 1
Promoter
  • 49
  • 42
  • 31
  • 16
  • 8
Format
  • 79
  • 36
  • 26
  • 19

Type:
cDNA
Application:
Cloning
Gene:
Glial Fibrillary Acidic Protein (GFAP)
Gene ID:
30646 (Zebrafish (Danio rerio), GFAP)
Synonyms:
GFAP, LOC100136168, gfap, Gfap
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4037339
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glial Fibrillary Acidic Protein (GFAP)
Gene ID:
2670 (Human, GFAP)
Synonyms:
GFAP, LOC100136168, gfap, Gfap
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3804099
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glial Fibrillary Acidic Protein (GFAP)
Gene ID:
2670 (Human, GFAP)
Synonyms:
GFAP, LOC100136168, gfap, Gfap
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3804100
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glial Fibrillary Acidic Protein (GFAP)
Gene ID:
24387 (Rat (Rattus), GFAP)
Synonyms:
GFAP, LOC100136168, gfap, Gfap
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045366
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glial Fibrillary Acidic Protein (GFAP)
Gene ID:
14580 (Mouse (Murine), GFAP)
Synonyms:
GFAP, LOC100136168, gfap, Gfap
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4002419
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glial Fibrillary Acidic Protein (GFAP)
Gene ID:
281189 (Cow (Bovine), GFAP)
Synonyms:
GFAP, LOC100136168, gfap, Gfap
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048893
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glial Fibrillary Acidic Protein (GFAP)
NCBI Accession:
NM_001131020
Species:
Mouse (Murine)
Synonyms:
GFAP, LOC100136168, gfap, Gfap
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3888180
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glial Fibrillary Acidic Protein (GFAP)
Species:
Human
Synonyms:
GFAP, LOC100136168, gfap, Gfap
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3888179
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Glial Fibrillary Acidic Protein
Species:
Human
Synonyms:
GFAP, AI836096, cb345, etID36982.3, gfapl, wu:fb34h11, wu:fk42c12, xx:af506734, zgc:110485
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3190134
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Glial Fibrillary Acidic Protein
Species:
Mouse (Murine)
Synonyms:
GFAP, AI836096, cb345, etID36982.3, gfapl, wu:fb34h11, wu:fk42c12, xx:af506734, zgc:110485
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3195555
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glial Fibrillary Acidic Protein (GFAP)
Gene ID:
30646 (Zebrafish (Danio rerio), GFAP)
Synonyms:
GFAP, LOC100136168, gfap, Gfap
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4037338
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Glial Fibrillary Acidic Protein (GFAP)
Species:
Human
Synonyms:
GFAP, LOC100136168, gfap, Gfap
Insert length:
1299 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5742654
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glial Fibrillary Acidic Protein (GFAP)
Gene ID:
2670 (Human, GFAP)
Synonyms:
GFAP, LOC100136168, gfap, Gfap
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3804097
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glial Fibrillary Acidic Protein (GFAP)
Gene ID:
2670 (Human, GFAP)
Synonyms:
GFAP, LOC100136168, gfap, Gfap
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3804101
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glial Fibrillary Acidic Protein (GFAP)
Gene ID:
24387 (Rat (Rattus), GFAP)
Synonyms:
GFAP, LOC100136168, gfap, Gfap
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045367
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glial Fibrillary Acidic Protein (GFAP)
Gene ID:
14580 (Mouse (Murine), GFAP)
Synonyms:
GFAP, LOC100136168, gfap, Gfap
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4002420
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glial Fibrillary Acidic Protein (GFAP)
Gene ID:
281189 (Cow (Bovine), GFAP)
Synonyms:
GFAP, LOC100136168, gfap, Gfap
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048894
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Glial Fibrillary Acidic Protein (GFAP)
Gene ID:
2670 (Human, GFAP)
Synonyms:
GFAP, LOC100136168, gfap, Gfap
Insert length:
1299 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5312439
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Glial Fibrillary Acidic Protein (GFAP)
Species:
Human
Synonyms:
GFAP, LOC100136168, gfap, Gfap
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948166

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3901470
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Glial Fibrillary Acidic Protein (GFAP)
Species:
Human
Synonyms:
GFAP, LOC100136168, gfap, Gfap
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948169

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3901473
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
  • <
  • 1

Synonyms and alternative names related to GFAP

  • glial fibrillary acidic protein (GFAP)
  • glial fibrillary acidic protein (LOC100136168)
  • glial fibrillary acidic protein (gfap)
  • glial fibrillary acidic protein (Gfap)
  • AI836096
  • cb345
  • etID36982.3
  • GFAP
  • gfapl
  • wu:fb34h11
  • wu:fk42c12
  • xx:af506734
  • zgc:110485

Gene-IDs for different species

GENE IDSPECIES
712941 Macaca mulatta
454741 Pan troglodytes
100136168 Oncorhynchus mykiss
100534495 Oreochromis niloticus
2670 Homo sapiens
24387 Rattus norvegicus
100720409 Cavia porcellus
101081938 Felis catus
396562 Sus scrofa
281189 Bos taurus
14580 Mus musculus
100352532 Oryctolagus cuniculus
419969 Gallus gallus
480495 Canis lupus familiaris
443220 Ovis aries
30646 Danio rerio
100172719 Pongo abelii
100033970 Equus caballus

Protein level used designations for GFAP

  • glial fibrillary acidic protein
  • glial fibrillary acidic protein alpha
  • intermediate filament
  • intermediate filament protein
  • zrf-1 antigen
Other products related to GFAP such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com