GP2 (Glycoprotein 2 (Zymogen Granule Membrane), GP2)

Short Description: GPI-linked protein that is a major component of pancreatic zymogen granule membranes
More information related to gene GP2.
Products related to GP2 Gene:
125 Products
Type
  • 121
  • 4
Species
  • 68
  • 30
  • 25
  • 2
Application
  • 78
  • 23
  • 23
  • 16
  • 1
Fusion tag
  • 37
  • 22
  • 17
  • 11
  • 8
Vector Backbone
  • 10
  • 10
  • 7
  • 6
  • 6
Vector
  • 50
  • 43
  • 12
  • 9
  • 5
Insert
  • 48
  • 37
  • 20
  • 8
  • 6
Oligo-Type
  • 3
  • 1
Resistance Gene
  • 48
  • 43
  • 26
  • 4
  • 2
Expression Type
  • 106
  • 55
  • 11
Selectable Marker
  • 31
  • 26
  • 11
  • 2
Promoter
  • 47
  • 30
  • 23
  • 15
  • 8
Format
  • 64
  • 27
  • 24
  • 10

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
Gene ID:
531420 (Cow (Bovine), GP2)
Synonyms:
GP2, Gp2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3861783
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
Gene ID:
67133 (Mouse (Murine), GP2)
Synonyms:
GP2, Gp2
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3990024
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
Gene ID:
2813 (Human, GP2)
Synonyms:
GP2, Gp2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3471896
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
Species:
Human
Synonyms:
GP2, Gp2
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3560511
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Glycoprotein 2 (Zymogen Granule Membrane)
Species:
Human
Synonyms:
ZAP75, 2310037I18Rik, AV060639, gp80
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3190608
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
ORF
Application:
Cloning
Gene:
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
Species:
Human
Synonyms:
GP2, Gp2
Insert length:
1152 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5752434
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
Gene ID:
531420 (Cow (Bovine), GP2)
Synonyms:
GP2, Gp2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3861782
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
Gene ID:
67133 (Mouse (Murine), GP2)
Synonyms:
GP2, Gp2
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3990023
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
Gene ID:
2813 (Human, GP2)
Synonyms:
GP2, Gp2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3471895
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
Gene ID:
2813 (Human, GP2)
Synonyms:
GP2, Gp2
Insert length:
1143 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5316847
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
Species:
Human
Synonyms:
GP2, Gp2
Insert length:
1152 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4437266
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
Species:
Human
Synonyms:
GP2, Gp2
Insert length:
1152 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4476171
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
Species:
Human
Synonyms:
GP2, Gp2
Insert length:
1152 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4703192
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
Species:
Human
Synonyms:
GP2, Gp2
Insert length:
1152 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4762546
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
Species:
Human
Synonyms:
GP2, Gp2
Insert length:
1152 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4767839
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
Species:
Human
Synonyms:
GP2, Gp2
Insert length:
1152 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4832322
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
NCBI Accession:
NM_001007242,NP_001007243
Species:
Human
Synonyms:
GP2, Gp2
Insert length:
1164 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5440582
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
NCBI Accession:
NM_001502,NP_001493
Species:
Human
Synonyms:
GP2, Gp2
Insert length:
1605 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5440583
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
NCBI Accession:
NM_001007241,NP_001007242
Species:
Human
Synonyms:
GP2, Gp2
Insert length:
1173 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5440584
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
NCBI Accession:
NM_001007240,NP_001007241
Species:
Human
Synonyms:
GP2, Gp2
Insert length:
1614 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5440585
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
  • <
  • 1

Synonyms and alternative names related to GP2

  • glycoprotein 2 (GP2)
  • glycoprotein 2 (zymogen granule membrane) (Gp2)
  • glycoprotein 2 (Gp2)
  • 2310037I18Rik
  • AV060639
  • gp80
  • ZAP75

Gene-IDs for different species

GENE IDSPECIES
695766 Macaca mulatta
100051807 Equus caballus
100303610 Sus scrofa
100414803 Callithrix jacchus
100451780 Pongo abelii
741636 Pan troglodytes
2813 Homo sapiens
67133 Mus musculus
531420 Bos taurus
171459 Rattus norvegicus
442972 Canis lupus familiaris

Protein level used designations for GP2

  • glycoprotein 2 (zymogen granule membrane)
  • pancreatic secretory granule membrane major glycoprotein GP2-like
  • zymogen granule membrane glycoprotein 2
  • pancreatic secretory granule membrane major glycoprotein GP2
  • pancreatic zymogen granule membrane associated protein GP2
  • pancreatic zymogen granule membrane protein GP-2
  • glycoprotein 80
  • secretory (zymogen) granule membrane glycoprotein GP2
  • zymogen granule membrane protein GP-2
Other products related to GP2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com