GP2 (Glycoprotein 2 (Zymogen Granule Membrane), GP2)

Short Description: GPI-linked protein that is a major component of pancreatic zymogen granule membranes
More information related to gene GP2.
Products related to GP2 Gene:
125 Products
  • 121
  • 4
  • 68
  • 30
  • 25
  • 2
  • 78
  • 23
  • 23
  • 16
  • 1
Fusion tag
  • 37
  • 22
  • 17
  • 11
  • 8
Vector Backbone
  • 10
  • 10
  • 7
  • 6
  • 6
  • 50
  • 43
  • 12
  • 9
  • 5
  • 48
  • 37
  • 20
  • 8
  • 6
  • 3
  • 1
Resistance Gene
  • 48
  • 43
  • 26
  • 4
  • 2
Expression Type
  • 106
  • 55
  • 11
Selectable Marker
  • 31
  • 26
  • 11
  • 2
  • 47
  • 30
  • 23
  • 15
  • 8
  • 64
  • 27
  • 24
  • 10
Supplier: Log in to see

Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
GP2, Gp2
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5752434
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
Gene ID:
67133 (Mouse (Murine), GP2)
GP2, Gp2
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3990024
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
Gene ID:
531420 (Cow (Bovine), GP2)
GP2, Gp2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3861783
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
Gene ID:
2813 (Human, GP2)
GP2, Gp2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3471896
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Quantitative real-time PCR
Glycoprotein 2 (Zymogen Granule Membrane)
ZAP75, 2310037I18Rik, AV060639, gp80
-20 °C
Catalog No. ABIN3190608
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
GP2, Gp2
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3560511
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
Gene ID:
2813 (Human, GP2)
GP2, Gp2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3471895
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
Gene ID:
531420 (Cow (Bovine), GP2)
GP2, Gp2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3861782
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
Gene ID:
67133 (Mouse (Murine), GP2)
GP2, Gp2
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3990023
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
Gene ID:
2813 (Human, GP2)
GP2, Gp2
Insert length:
1143 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5316847
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Protein Expression
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
GP2, Gp2
Insert length:
1152 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4437266
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Protein Expression
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
GP2, Gp2
Insert length:
1152 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4476171
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
GP2, Gp2
Insert length:
1152 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4832322
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
GP2, Gp2
Insert length:
1152 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4762546
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
GP2, Gp2
Insert length:
1152 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4767839
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
GP2, Gp2
Insert length:
1152 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4703192
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Protein Expression
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
NCBI Accession:
GP2, Gp2
Insert length:
1164 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5440582
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Protein Expression
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
NCBI Accession:
GP2, Gp2
Insert length:
1605 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5440583
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Protein Expression
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
NCBI Accession:
GP2, Gp2
Insert length:
1173 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5440584
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Protein Expression
Glycoprotein 2 (Zymogen Granule Membrane) (GP2)
NCBI Accession:
GP2, Gp2
Insert length:
1614 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5440585
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
  • <
  • 1

Synonyms and alternative names related to GP2

  • glycoprotein 2 (GP2)
  • glycoprotein 2 (zymogen granule membrane) (Gp2)
  • glycoprotein 2 (Gp2)
  • 2310037I18Rik
  • AV060639
  • gp80
  • ZAP75

Gene-IDs for different species

695766 Macaca mulatta
100051807 Equus caballus
100303610 Sus scrofa
100414803 Callithrix jacchus
100451780 Pongo abelii
741636 Pan troglodytes
2813 Homo sapiens
67133 Mus musculus
531420 Bos taurus
171459 Rattus norvegicus
442972 Canis lupus familiaris

Protein level used designations for GP2

  • glycoprotein 2 (zymogen granule membrane)
  • pancreatic secretory granule membrane major glycoprotein GP2-like
  • zymogen granule membrane glycoprotein 2
  • pancreatic secretory granule membrane major glycoprotein GP2
  • pancreatic zymogen granule membrane associated protein GP2
  • pancreatic zymogen granule membrane protein GP-2
  • glycoprotein 80
  • secretory (zymogen) granule membrane glycoprotein GP2
  • zymogen granule membrane protein GP-2
Other products related to GP2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website