GPR146 (G Protein-Coupled Receptor 146, GPR146)

Short Description: Orphan receptor.
More information related to gene GPR146.
Products related to GPR146 Gene:
Type
  • 104
  • 1
Species
  • 37
  • 37
  • 25
  • 2
  • 2
Application
  • 59
  • 31
  • 19
  • 16
Fusion tag
  • 37
  • 13
  • 12
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 36
  • 33
  • 16
  • 9
  • 6
Insert
  • 45
  • 25
  • 18
  • 8
  • 6
Oligo-Type
  • 1
Resistance Gene
  • 41
  • 37
  • 20
  • 6
  • 2
Expression Type
  • 98
  • 52
  • 2
Selectable Marker
  • 27
  • 26
  • 1
Promoter
  • 32
  • 28
  • 16
  • 12
  • 8
Format
  • 36
  • 29
  • 22
  • 18
105 Products

Type:
ORF
Application:
Cloning
Gene:
G Protein-Coupled Receptor 146 (GPR146)
Species:
Human
Synonyms:
GPR146, gpr146, Gpr146, gpr146.L
Insert length:
1002 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5724012
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
G Protein-Coupled Receptor 146 (GPR146)
Gene ID:
398996 (Xenopus laevis, GPR146)
Synonyms:
GPR146, gpr146, Gpr146, gpr146.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3846415
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
G Protein-Coupled Receptor 146 (GPR146)
Gene ID:
80290 (Mouse (Murine), GPR146)
Synonyms:
GPR146, gpr146, Gpr146, gpr146.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3827062
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
G Protein-Coupled Receptor 146 (GPR146)
Gene ID:
100125164 (Xenopus tropicalis, GPR146)
Synonyms:
GPR146, gpr146, Gpr146, gpr146.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4032081
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
G Protein-Coupled Receptor 146 (GPR146)
Gene ID:
115330 (Human, GPR146)
Synonyms:
GPR146, gpr146, Gpr146, gpr146.L
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4094470
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
G Protein-Coupled Receptor 146 (GPR146)
Gene ID:
398996 (Xenopus laevis, GPR146)
Synonyms:
GPR146, gpr146, Gpr146, gpr146.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3846416
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
G Protein-Coupled Receptor 146 (GPR146)
Gene ID:
80290 (Mouse (Murine), GPR146)
Synonyms:
GPR146, gpr146, Gpr146, gpr146.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3827061
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
G Protein-Coupled Receptor 146 (GPR146)
Gene ID:
100125164 (Xenopus tropicalis, GPR146)
Synonyms:
GPR146, gpr146, Gpr146, gpr146.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4032082
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
G Protein-Coupled Receptor 146 (GPR146)
Gene ID:
115330 (Human, GPR146)
Synonyms:
GPR146, gpr146, Gpr146, gpr146.L
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4094469
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
G Protein-Coupled Receptor 146 (GPR146)
Gene ID:
115330 (Human, GPR146)
Synonyms:
GPR146, gpr146, Gpr146, gpr146.L
Insert length:
1002 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5316515
$189.37
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
G Protein-Coupled Receptor 146 (GPR146)
Species:
Human
Synonyms:
GPR146, gpr146, Gpr146, gpr146.L
Insert length:
1002 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4437305
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
G Protein-Coupled Receptor 146 (GPR146)
Species:
Human
Synonyms:
GPR146, gpr146, Gpr146, gpr146.L
Insert length:
1002 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4476210
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
G Protein-Coupled Receptor 146 (GPR146)
Species:
Human
Synonyms:
GPR146, gpr146, Gpr146, gpr146.L
Insert length:
1002 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4762585
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
G Protein-Coupled Receptor 146 (GPR146)
Species:
Human
Synonyms:
GPR146, gpr146, Gpr146, gpr146.L
Insert length:
1002 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4767878
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
G Protein-Coupled Receptor 146 (GPR146)
Species:
Human
Synonyms:
GPR146, gpr146, Gpr146, gpr146.L
Insert length:
1002 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4703258
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
G Protein-Coupled Receptor 146 (GPR146)
Species:
Human
Synonyms:
GPR146, gpr146, Gpr146, gpr146.L
Insert length:
1002 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4832388
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
G Protein-Coupled Receptor 146 (GPR146)
Gene ID:
115330 (Human, GPR146)
Synonyms:
GPR146, gpr146, Gpr146, gpr146.L
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3395763
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
G Protein-Coupled Receptor 146 (GPR146)
Gene ID:
115330 (Human, GPR146)
Synonyms:
GPR146, gpr146, Gpr146, gpr146.L
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3420496
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
G Protein-Coupled Receptor 146 (GPR146)
Gene ID:
115330 (Human, GPR146)
Synonyms:
GPR146, gpr146, Gpr146, gpr146.L
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3423734
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
G Protein-Coupled Receptor 146 (GPR146)
NCBI Accession:
NM_030258,NP_084534
Species:
Mouse (Murine)
Synonyms:
GPR146, gpr146, Gpr146, gpr146.L
Insert length:
1002 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3324035
$340.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to GPR146

  • G protein-coupled receptor 146 (GPR146)
  • G protein-coupled receptor 146 (gpr146)
  • G protein-coupled receptor 146 (Gpr146)
  • G protein-coupled receptor 146 L homeolog (gpr146.L)
  • BC003323
  • GPR146
  • PGR8
  • RGD1560731
  • zgc:153785

Gene-IDs for different species

GENE IDSPECIES
416456 Gallus gallus
491603 Canis lupus familiaris
506876 Bos taurus
565192 Danio rerio
100125164 Xenopus (Silurana) tropicalis
115330 Homo sapiens
80290 Mus musculus
398996 Xenopus laevis
498153 Rattus norvegicus

Protein level used designations for GPR146

  • probable G-protein coupled receptor 146
  • G protein-coupled receptor 146
  • G protein-coupled receptor PGR8
  • G-protein coupled receptor PGR8
Other products related to GPR146 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com