GPRC5A (G Protein-Coupled Receptor, Family C, Group 5, Member A, GPRC5A)

Short Description: This gene encodes a member of the type 3 G protein-coupling receptor family, characterized by the signature 7-transmembrane domain motif. The encoded protein may be involved in interaction between retinoid acid and G protein signalling pathways. Retinoic acid plays a critical role in development, cellular growth, and differentiation. This gene may play a role in embryonic development and epithelial cell differentiation. [provided by RefSeq, Jul 2008].
More information related to gene GPRC5A.
Products related to GPRC5A Gene:
96 Products
  • 93
  • 3
  • 35
  • 29
  • 28
  • 2
  • 2
  • 52
  • 28
  • 22
  • 16
Fusion tag
  • 36
  • 14
  • 10
  • 9
  • 8
Vector Backbone
  • 8
  • 6
  • 6
  • 6
  • 6
  • 35
  • 31
  • 12
  • 9
  • 5
  • 38
  • 20
  • 19
  • 8
  • 6
  • 3
Resistance Gene
  • 38
  • 31
  • 20
  • 4
  • 2
Expression Type
  • 90
  • 47
Selectable Marker
  • 26
  • 22
  • 29
  • 29
  • 14
  • 13
  • 8
  • 31
  • 27
  • 22
  • 16

Protein Expression
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
NCBI Accession:
GPRC5A, Gprc5a
Insert length:
1074 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5437991
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Protein Expression
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
NCBI Accession:
Gene ID:
9052 (Human, GPRC5A)
GPRC5A, Gprc5a
Insert length:
1074 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
RT/-20 °C
Catalog No. ABIN4919497
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Protein Expression, Cloning
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Gene ID:
516026 (Cow (Bovine), GPRC5A)
GPRC5A, Gprc5a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3859699
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Gene ID:
232431 (Mouse (Murine), GPRC5A)
GPRC5A, Gprc5a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3836598
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Gene ID:
232431 (Mouse (Murine), GPRC5A)
GPRC5A, Gprc5a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3836603
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Gene ID:
398886 (Xenopus laevis, GPRC5A)
GPRC5A, Gprc5a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3846212
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Gene ID:
9052 (Human, GPRC5A)
GPRC5A, Gprc5a
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4088056
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Gene ID:
312790 (Rat (Rattus), GPRC5A)
GPRC5A, Gprc5a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4053307
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
GPRC5A, Gprc5a
Insert length:
1074 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5751655
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression, Cloning
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Gene ID:
398886 (Xenopus laevis, GPRC5A)
GPRC5A, Gprc5a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3846211
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Gene ID:
516026 (Cow (Bovine), GPRC5A)
GPRC5A, Gprc5a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3859700
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Gene ID:
232431 (Mouse (Murine), GPRC5A)
GPRC5A, Gprc5a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3836602
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Gene ID:
232431 (Mouse (Murine), GPRC5A)
GPRC5A, Gprc5a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3836599
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Gene ID:
9052 (Human, GPRC5A)
GPRC5A, Gprc5a
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4088057
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Gene ID:
312790 (Rat (Rattus), GPRC5A)
GPRC5A, Gprc5a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4053308
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Gene ID:
9052 (Human, GPRC5A)
GPRC5A, Gprc5a
Insert length:
1074 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5314535
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Protein Expression
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
NCBI Accession:
GPRC5A, Gprc5a
Insert length:
2600 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3384293
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Protein Expression
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
GPRC5A, Gprc5a
Insert length:
1074 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4476251
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
GPRC5A, Gprc5a
Insert length:
1074 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4703326
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
GPRC5A, Gprc5a
Insert length:
1074 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4762626
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to GPRC5A

  • G protein-coupled receptor class C group 5 member A (GPRC5A)
  • G protein-coupled receptor, family C, group 5, member A (Gprc5a)
  • G protein-coupled receptor, class C, group 5, member A (Gprc5a)
  • G protein-coupled receptor class C group 5 member A (Gprc5a)
  • GPCR5A
  • RAI3
  • Rai3
  • RAIG1
  • Raig1

Gene-IDs for different species

9052 Homo sapiens
232431 Mus musculus
312790 Rattus norvegicus
516026 Bos taurus
486680 Canis lupus familiaris
417960 Gallus gallus
100730088 Cavia porcellus
101110748 Ovis aries
100349493 Oryctolagus cuniculus
100624186 Sus scrofa

Protein level used designations for GPRC5A

  • G-protein coupled receptor family C group 5 member A
  • RAIG-1
  • orphan G-protein-coupling receptor PEIG-1
  • retinoic acid induced 3
  • retinoic acid responsive
  • retinoic acid-induced gene 1 protein
  • retinoic acid-induced protein 3
Other products related to GPRC5A such as antibodies, ELISA kits and high-purity proteins are available on our partner website