GPRC5A (G Protein-Coupled Receptor, Family C, Group 5, Member A, GPRC5A)

Short Description: This gene encodes a member of the type 3 G protein-coupling receptor family, characterized by the signature 7-transmembrane domain motif. The encoded protein may be involved in interaction between retinoid acid and G protein signalling pathways. Retinoic acid plays a critical role in development, cellular growth, and differentiation. This gene may play a role in embryonic development and epithelial cell differentiation. [provided by RefSeq, Jul 2008].
More information related to gene GPRC5A.
Products related to GPRC5A Gene:
96 Products
Type
  • 93
  • 3
Species
  • 35
  • 29
  • 28
  • 2
  • 2
Application
  • 52
  • 28
  • 22
  • 16
Fusion tag
  • 36
  • 14
  • 10
  • 9
  • 8
Vector Backbone
  • 8
  • 6
  • 6
  • 6
  • 6
Vector
  • 35
  • 31
  • 12
  • 9
  • 5
Insert
  • 38
  • 20
  • 19
  • 8
  • 6
Oligo-Type
  • 3
Resistance Gene
  • 38
  • 31
  • 20
  • 4
  • 2
Expression Type
  • 90
  • 47
Selectable Marker
  • 26
  • 22
Promoter
  • 29
  • 29
  • 14
  • 13
  • 8
Format
  • 31
  • 27
  • 22
  • 16
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Species:
Human
Synonyms:
GPRC5A, Gprc5a
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5751655
$70.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
NCBI Accession:
NM_003979,NP_003970
Species:
Human
Synonyms:
GPRC5A, Gprc5a
Insert length:
1074 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5437991
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
NCBI Accession:
NM_003979
Gene ID:
9052 (Human, GPRC5A)
Synonyms:
GPRC5A, Gprc5a
Insert length:
1074 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4919497
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Gene ID:
312790 (Rat (Rattus), GPRC5A)
Synonyms:
GPRC5A, Gprc5a
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4053307
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Gene ID:
9052 (Human, GPRC5A)
Synonyms:
GPRC5A, Gprc5a
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4088056
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Gene ID:
516026 (Cow (Bovine), GPRC5A)
Synonyms:
GPRC5A, Gprc5a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3859699
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Gene ID:
398886 (Xenopus laevis, GPRC5A)
Synonyms:
GPRC5A, Gprc5a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3846212
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Gene ID:
232431 (Mouse (Murine), GPRC5A)
Synonyms:
GPRC5A, Gprc5a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3836598
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Gene ID:
232431 (Mouse (Murine), GPRC5A)
Synonyms:
GPRC5A, Gprc5a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3836603
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Gene ID:
232431 (Mouse (Murine), GPRC5A)
Synonyms:
GPRC5A, Gprc5a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3836602
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Gene ID:
232431 (Mouse (Murine), GPRC5A)
Synonyms:
GPRC5A, Gprc5a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3836599
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Gene ID:
398886 (Xenopus laevis, GPRC5A)
Synonyms:
GPRC5A, Gprc5a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3846211
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Gene ID:
516026 (Cow (Bovine), GPRC5A)
Synonyms:
GPRC5A, Gprc5a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3859700
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Gene ID:
312790 (Rat (Rattus), GPRC5A)
Synonyms:
GPRC5A, Gprc5a
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4053308
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Gene ID:
9052 (Human, GPRC5A)
Synonyms:
GPRC5A, Gprc5a
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4088057
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Gene ID:
9052 (Human, GPRC5A)
Synonyms:
GPRC5A, Gprc5a
Insert length:
1074 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5314535
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Species:
Human
Synonyms:
GPRC5A, Gprc5a
Insert length:
1074 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4437346
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Species:
Human
Synonyms:
GPRC5A, Gprc5a
Insert length:
1074 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4476251
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Species:
Human
Synonyms:
GPRC5A, Gprc5a
Insert length:
1074 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4832456
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
G Protein-Coupled Receptor, Family C, Group 5, Member A (GPRC5A)
Species:
Human
Synonyms:
GPRC5A, Gprc5a
Insert length:
1074 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4762626
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to GPRC5A

  • G protein-coupled receptor class C group 5 member A (GPRC5A)
  • G protein-coupled receptor, family C, group 5, member A (Gprc5a)
  • G protein-coupled receptor, class C, group 5, member A (Gprc5a)
  • G protein-coupled receptor class C group 5 member A (Gprc5a)
  • GPCR5A
  • RAI3
  • Rai3
  • RAIG1
  • Raig1

Gene-IDs for different species

GENE IDSPECIES
9052 Homo sapiens
232431 Mus musculus
312790 Rattus norvegicus
516026 Bos taurus
486680 Canis lupus familiaris
417960 Gallus gallus
100730088 Cavia porcellus
101110748 Ovis aries
100349493 Oryctolagus cuniculus
100624186 Sus scrofa

Protein level used designations for GPRC5A

  • G-protein coupled receptor family C group 5 member A
  • RAIG-1
  • orphan G-protein-coupling receptor PEIG-1
  • retinoic acid induced 3
  • retinoic acid responsive
  • retinoic acid-induced gene 1 protein
  • retinoic acid-induced protein 3
Other products related to GPRC5A such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com