INSL5 (Insulin-Like 5, INSL5)

Short Description: The protein encoded by this gene contains a classical signature of the insulin superfamily and is highly similar to relaxin 3 (RLN3/INSL7). [provided by RefSeq, Jul 2008].
More information related to gene INSL5.
Products related to INSL5 Gene:
76 Products
  • 72
  • 4
  • 38
  • 30
  • 8
  • 32
  • 24
  • 18
  • 12
Fusion tag
  • 33
  • 11
  • 7
  • 6
  • 6
Vector Backbone
  • 12
  • 4
  • 4
  • 4
  • 4
  • 24
  • 19
  • 14
  • 8
  • 6
  • 32
  • 14
  • 14
  • 6
  • 4
  • 4
Resistance Gene
  • 34
  • 23
  • 12
  • 3
  • 2
Expression Type
  • 59
  • 34
Selectable Marker
  • 30
  • 18
  • 22
  • 21
  • 8
  • 6
  • 6
  • 25
  • 18
  • 18
  • 15
Supplier: Log in to see

Protein Expression
Insulin-Like 5 (INSL5)
NCBI Accession:
INSL5, Insl5
Insert length:
408 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5440446
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see
ISO 9001:2008

Protein Expression
Insulin-Like 5 (INSL5)
NCBI Accession:
Gene ID:
10022 (Human, INSL5)
INSL5, Insl5
Insert length:
408 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
RT/-20 °C
Catalog No. ABIN4919325
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days
Supplier: Log in to see

Insulin-Like 5 (INSL5)
Gene ID:
100008569 (Zebrafish (Danio rerio), INSL5)
INSL5, Insl5
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3484448
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Insulin-Like 5 (INSL5)
Gene ID:
100008569 (Zebrafish (Danio rerio), INSL5)
INSL5, Insl5
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3484449
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Insulin-Like 5 (INSL5)
Gene ID:
566602 (Zebrafish (Danio rerio), INSL5)
INSL5, Insl5
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3484332
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Insulin-Like 5 (INSL5)
Gene ID:
566602 (Zebrafish (Danio rerio), INSL5)
INSL5, Insl5
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3484333
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Insulin-Like 5 (INSL5)
Gene ID:
23919 (Mouse (Murine), INSL5)
INSL5, Insl5
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4218417
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Insulin-Like 5 (INSL5)
Gene ID:
10022 (Human, INSL5)
INSL5, Insl5
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3483869
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Insulin-Like 5 (INSL5)
Gene ID:
10022 (Human, INSL5)
INSL5, Insl5
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3483870
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Insulin-Like 5 (INSL5)
Gene ID:
100008569 (Zebrafish (Danio rerio), INSL5)
INSL5, Insl5
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3484447
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Insulin-Like 5 (INSL5)
Gene ID:
100008569 (Zebrafish (Danio rerio), INSL5)
INSL5, Insl5
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3484446
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Insulin-Like 5 (INSL5)
Gene ID:
566602 (Zebrafish (Danio rerio), INSL5)
INSL5, Insl5
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3484330
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Insulin-Like 5 (INSL5)
Gene ID:
566602 (Zebrafish (Danio rerio), INSL5)
INSL5, Insl5
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3484331
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Insulin-Like 5 (INSL5)
Gene ID:
23919 (Mouse (Murine), INSL5)
INSL5, Insl5
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4218418
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Insulin-Like 5 (INSL5)
Gene ID:
10022 (Human, INSL5)
INSL5, Insl5
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4001316
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Insulin-Like 5 (INSL5)
Gene ID:
10022 (Human, INSL5)
INSL5, Insl5
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4001315
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression
Insulin-Like 5 (INSL5)
NCBI Accession:
Mouse (Murine)
INSL5, Insl5
Insert length:
438 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3326382
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Protein Expression
Insulin-Like 5 (INSL5)
Gene ID:
10022 (Human, INSL5)
INSL5, Insl5
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3413946
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Insulin-Like 5 (INSL5)
NCBI Accession:
INSL5, Insl5
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5752388
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Protein Expression
Insulin-Like 5 (INSL5)
NCBI Accession:
INSL5, Insl5
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3301679
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
  • <
  • 1

Synonyms and alternative names related to INSL5

  • insulin like 5 (INSL5)
  • insulin-like 5 (Insl5)
  • PRO182
  • RIF2
  • UNQ156

Gene-IDs for different species

10022 Homo sapiens
23919 Mus musculus
743871 Pan troglodytes

Protein level used designations for INSL5

  • insulin-like peptide 5
  • insulin-like peptide INSL5
  • prepro-INSL5
  • relaxin/insulin-like factor 2
  • relaxin/insulin-like protein
Other products related to INSL5 such as antibodies, ELISA kits and high-purity proteins are available on our partner website