INSL5 (Insulin-Like 5, INSL5)

Short Description: The protein encoded by this gene contains a classical signature of the insulin superfamily and is highly similar to relaxin 3 (RLN3/INSL7). [provided by RefSeq, Jul 2008].
More information related to gene INSL5.
Products related to INSL5 Gene:
76 Products
Type
  • 72
  • 4
Species
  • 38
  • 30
  • 8
Application
  • 32
  • 24
  • 18
  • 12
Fusion tag
  • 33
  • 11
  • 7
  • 6
  • 6
Vector Backbone
  • 12
  • 4
  • 4
  • 4
  • 4
Vector
  • 24
  • 19
  • 14
  • 8
  • 6
Insert
  • 32
  • 14
  • 14
  • 6
  • 4
Oligo-Type
  • 4
Resistance Gene
  • 34
  • 23
  • 12
  • 3
  • 2
Expression Type
  • 59
  • 34
Selectable Marker
  • 30
  • 18
Promoter
  • 22
  • 21
  • 8
  • 6
  • 6
Format
  • 25
  • 18
  • 18
  • 15

Type:
ORF
Application:
Protein Expression
Gene:
Insulin-Like 5 (INSL5)
NCBI Accession:
NM_005478,NP_005469
Species:
Human
Synonyms:
INSL5, Insl5
Insert length:
408 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5440446
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Insulin-Like 5 (INSL5)
NCBI Accession:
NM_005478
Gene ID:
10022 (Human, INSL5)
Synonyms:
INSL5, Insl5
Insert length:
408 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4919325
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Insulin-Like 5 (INSL5)
Gene ID:
100008569 (Zebrafish (Danio rerio), INSL5)
Synonyms:
INSL5, Insl5
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3484449
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Insulin-Like 5 (INSL5)
Gene ID:
566602 (Zebrafish (Danio rerio), INSL5)
Synonyms:
INSL5, Insl5
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3484332
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Insulin-Like 5 (INSL5)
Gene ID:
566602 (Zebrafish (Danio rerio), INSL5)
Synonyms:
INSL5, Insl5
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3484333
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Insulin-Like 5 (INSL5)
Gene ID:
100008569 (Zebrafish (Danio rerio), INSL5)
Synonyms:
INSL5, Insl5
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3484448
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Insulin-Like 5 (INSL5)
Gene ID:
10022 (Human, INSL5)
Synonyms:
INSL5, Insl5
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3483869
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Insulin-Like 5 (INSL5)
Gene ID:
10022 (Human, INSL5)
Synonyms:
INSL5, Insl5
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3483870
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Insulin-Like 5 (INSL5)
Gene ID:
23919 (Mouse (Murine), INSL5)
Synonyms:
INSL5, Insl5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4218417
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Insulin-Like 5 (INSL5)
Gene ID:
566602 (Zebrafish (Danio rerio), INSL5)
Synonyms:
INSL5, Insl5
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3484330
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Insulin-Like 5 (INSL5)
Gene ID:
566602 (Zebrafish (Danio rerio), INSL5)
Synonyms:
INSL5, Insl5
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3484331
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Insulin-Like 5 (INSL5)
Gene ID:
100008569 (Zebrafish (Danio rerio), INSL5)
Synonyms:
INSL5, Insl5
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3484446
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Insulin-Like 5 (INSL5)
Gene ID:
100008569 (Zebrafish (Danio rerio), INSL5)
Synonyms:
INSL5, Insl5
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3484447
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Insulin-Like 5 (INSL5)
Gene ID:
10022 (Human, INSL5)
Synonyms:
INSL5, Insl5
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4001316
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Insulin-Like 5 (INSL5)
Gene ID:
10022 (Human, INSL5)
Synonyms:
INSL5, Insl5
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4001315
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Insulin-Like 5 (INSL5)
Gene ID:
23919 (Mouse (Murine), INSL5)
Synonyms:
INSL5, Insl5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4218418
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Insulin-Like 5 (INSL5)
NCBI Accession:
NM_001290648,NP_001277577
Species:
Mouse (Murine)
Synonyms:
INSL5, Insl5
Insert length:
438 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3326382
$200.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Insulin-Like 5 (INSL5)
Gene ID:
10022 (Human, INSL5)
Synonyms:
INSL5, Insl5
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3413946
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Insulin-Like 5 (INSL5)
NCBI Accession:
NM_005478,NP_005469
Species:
Human
Synonyms:
INSL5, Insl5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3301679
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Application:
RNA Interference
Gene:
Insulin-Like 5
Species:
Human
Synonyms:
PRO182, UNQ156, RIF2
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • INSL5 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3346505
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to INSL5

  • insulin like 5 (INSL5)
  • insulin-like 5 (Insl5)
  • PRO182
  • RIF2
  • UNQ156

Gene-IDs for different species

GENE IDSPECIES
10022 Homo sapiens
23919 Mus musculus
743871 Pan troglodytes

Protein level used designations for INSL5

  • insulin-like peptide 5
  • insulin-like peptide INSL5
  • prepro-INSL5
  • relaxin/insulin-like factor 2
  • relaxin/insulin-like protein
Other products related to INSL5 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com